Kahvena rebeccae Tedersoo, 2024

Tedersoo, Leho, Magurno, Franco, Alkahtani, Saad & Mikryukov, Vladimir, 2024, Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes), MycoKeys 107, pp. 249-271 : 249-271

Kahvena rebeccae Tedersoo sp. nov.

Diagnosis.

Separation from other species of Kahvena based on the ITS region (ITS 2 positions 200–218 cattcgcaggaatagccag; one mismatch allowed) and from other species of Endogonomycetes based on LSU (positions 653–683 acgcaagctccagatcgaatctccgggctaa; one mismatch allowed) as indicated in Fig. 5 .

Type.

Soil eDNA sample TUE 100738 (holotype); eDNA sequence EUK 1634339 (lectotype); GSMc plot G 4196, Populus - Picea - Pinus forest (soil sample TUE 000738 ) in Kahvena , Estonia (58.27991 ° N, 25.23165 ° E) .

Description.

Other sequences: EUK 1635883 – EUK 1635886 (type locality); EUK 1631811 (GSMc plot G 2767, mixed woodland soil at Mäebe, Estonia, 58.30937 ° N, 22.07618 ° E); KF 618358 ( Picea mariana forest soil, AK, USA); MT 596306 (Tobiotsuka Kofun, Japan, 34.6355 ° N, 133.6814 ° E); KU 062529 (unknown source); and KF 565426 (Duke Forest, NC, USA, 35.97 ° N, - 79.09 ° E), isolated by Rebecca C. Mueller ( Mueller et al. 2014).

Etymology.

Kahvena (Estonian) refers to type locality; and Rebecca (English) refers to the first name of Rebecca C. Mueller, who collected the first materials belonging to this genus and the type species.

Notes.

Found from temperate and subarctic forests in Europe, Asia and North America, with ITS and LSU sequences differing up to 4 % (excluding a 29 - base deletion in EUK 1631811 and KU 062529) and 1.5 %, respectively. Considered as a single species because of high intraspecific variation amongst common sequence variants in the type locality (2 % in ITS and 1 % in LSU, representing both indels and substitutions).

Figures

Figure 5. Diagnostic barcodes for Kahvena rebeccae relative to closely-related taxa in ITS 2 and LSU.