Homaledra howardi Hayden, 2021

Hayden, James E., 2021, Two new species of palm-leaf skeletonizers (Lepidoptera: Pterolonchidae: Homaledra Busck), Insecta Mundi 2021 (859), pp. 1-24 : 10-15

Homaledra howardi Hayden , new species

( Fig. 3, 4, 9 , 12, 16, 18, 23 , 30, 31 , 35 , 39, 42, 44, 46 , 53–55 , 59 )

Type material. Holotype ♂: [white label] “ USA, FL, M.- Dade Co. Miami 7821 SW 22 St. on Livistona chinensis . 29-VIII-2017 G. Gonzalez E17-3497 Eclosed 9–13 Sep. 2017 ”, [blue label] “ J.E. Hayden photo index 456” ( FSCA).

Paratypes: USA: Florida: Broward Co.: 1♂: [no site], X-1999, F.W. Howard; 3♀, 1 undet. sex: BCC, 20-IX- 2002, Washingtonia robusta, F.W. Howard, L 347, L350, L351, L358; 1♂: same data except 17-IX-2002, L357; 1♀: same data except 17-IX-2002, L354, MGCL slide 5024 (wings); 1♂: FLREC, 29-VII-2002, Cocos nucifera, F.W. Howard, L 357, slide MGCL 4634; 1♀: Ft. Laud., 27-VI-2002, Corypha XFR Sabal, F.W. Howard, L 365; 3♀: FLREC, 17-II-2003, Latania sp. , S. Ortiz, L637, L638, L641, [one] slide MGCL 4643; 1♀: same data except Cocos nucifera , L642; Collier Co.: 2♂, 1♀: Naples, 10040 Greenway Road, reared on Bismarckia nobilis leaves, 13-I- 2016, S. Krueger, E16-577; 1♂: same data, MGCL slide 3296; 1♀: same data, MGCL slide 3297 (genitalia and wings); 1♂: Naples, 4410 32 nd Ave. SW, reared on Sabal palmetto , 5 Dec. 2018, S. Krueger, E18-6380; 1♀: same data, slide MGCL 4997; Miami-Dade Co.: 2♂: Coral Gables, US 1 & Granada, reared on royal palm, 10-IV- 2012, H. Mayer, E12-3258; 1♂: Miami, 10360 SW 118 St. on house wall, 10-IV-2015, O. Garcia, E15-1792, slide MGCL 2799; 1♂, 1♀: Palmetto Bay, 17525 SW 87 Ave., raised on fan palm, 14-X-2015, L. Bradshaw, E15-5869, slides MGCL 3099 ♂, 3102 ♀; Dade U.M., 24-II-2003, Sabal palmetto, Bromet & Ortiz, L 644, L648, L649; 1♂: same data except Thrinax sp. , L651 ( USNM); 1♀: same data except Thrinax sp. , L653 ( FSCA); 1♂, 2♀: same data as holotype, [one] slide 4497 ♀ (1♂, 1♀: FSCA, 1♀: USNM); 1♂, 1♀: Miami, 17960 SW 232 St. on Cocos nucifera , 26-VII-2018, W. Mazuk, E18-4018; 1♂: Coral Gables, USDA ARS SHRS, 25.6429, −80.2946, suction trap, 11–18-IV-2016, S. Halbert, MGCL slide 4259 (wings); 1♂: same data except 22-II–1-III-2016, slide MGCL 3335 (genitalia and wings); 1♂: same data except 7–13-III-2017, H. Escobar, slide MGCL 4139; Palm Beach Co.: 1♂: West Palm Beach, X-1999, B. Turney, ex Cocos nucifera , slide JBH 2016; 1♀: West Palm Beach, 10-X-1999, B. Turney, slide MGCL 4261; 1♂, 1♀: West Palm Beach, 27-VI-2002, Latania sp. , David H. Baquerizo, L368 ( USNM); 1♀: same data except L369, MGCL slide 5023 ( FSCA); 1♂: same data except on Corypha umbraculifera , L370. County unknown: 1♀: US 27, 5-III-2003, Washingtonia robusta, F.W. Howard, L 655. DOMINICAN REPUBLIC: One slide of ♂ genitalia: “ Homaledra sabalella Ch. on palm San Domingo W. Isd. [?] AB, XI-1928, USNM 146,320” ( USNM).

Other material examined (imagines unless indicated, sex not examined for most). USA: Florida: Broward Co.: 1 larva: Parkland, 8055 NW 82nd Terrace, 26.3283, −80.2367, 1-II-2019, Bismarckia nobilis, S. Webb ; 6 specimens: [no site], X-1999, F.W. Howard ; 1♀: same data, slide MGCL 3388 ; 1: [no site], 23-IX-1999, B. Turney ; 1: [no site], 10-X-1999, B. Turney ; 2: Broward Community College, 27-X-1999, B. Turney; 2: [no site], 11-V-2001, Livistona, J. Lord, L 85–86; 1: [no site], Sabal palmetto , 22-V-2001, J. Lord , L88 ; 1: same data except 3-VII-2001, L90 ; 3: same data except 18-VII-2001, L94, L99, L100 ; 10: [no site], 21-II-2002, Cocos nucifera, J. Lord, L 61–65, L67, L68, L73, L77, L79; 4: FLREC, 9-III-2002, Cocos nucifera, J. Lord, L 81–84 ; 3: same data except Washingtonia robusta , L116–118 ; 2: FLREC, 11-III-2002, Sabal palmetto, J. Lord, L 119, L120 ; 7: FLREC, 27-III-2002, Washingtonia robusta, J. Lord and D.H. Baquerizo, L 121–124, L235–237 ; 1: FLREC, 3-IV-2002, Serenoa repens, D.H. Baquerizo, L 246 ; 3: FLREC, 16-IV-2002, Sabal palmetto, J. Lord, L 239–241 ; 2: FLREC, 22-IV-2002, Sabal palmetto, D.H. Baquerizo, L 244, L245 ; 175: FLREC, 23-IV-2002, Cocos nucifera, D.H. Baquerizo, L 127–164, L166–196, L198–234, L276–333, L335–345 ; 2: FLREC, 7-V-2002, Sabal palmetto, D.H. Baquerizo, L 242, L243 ; 3: same data except Serenoa repens , L247, L273, L274 ; 24: same data except Latania sp. , L248–272 ; Collier Co.: 2 larvae: Naples, 10040 Greenway Road, 13-I-2016, Bismarckia nobilis, S. Krueger ; 3 larvae: Naples, 4410 32nd Ave. SW, 5-XII-2018, Sabal palmetto, S. Krueger ; Miami-Dade Co.: 32 specimens: Cutler / Coral Gables, USDA ARS SHRS, 25.6429, −80.2946, suction trap, S. Halbert, H. Escobar, J. Farnum, 20–27-IV-2015, 8–15-XII-2015, 11–18- IV-2016, 25-IV–2-V-2016, 2–9-V-2016, 27-VI–5-VII-2016, 5–11-VII-2016, 18–25-VII-2016, 16–22-VIII-2016 ; 19–27-XII-2016, 1–17-I-2017, 13–20-II-2017, 20–27-II-2017, 7–13-III-2017, 1–8-V-2017, 16-VI–5-VII-2017, 21–30-V-2018, 24–30-I-2019 ; 2 larvae, 2 pupae: Coral Gables, 755 Tiziano Ave., Livistona chinensis , 20-VIII-1993, D. Fisk; 3 larvae: Coral Gables, ARS SHRS, 25.64236, −80.29494, 30-XI-2018, Zombia antillarum, J. Hayden, S. Bolton, 1 larva: Homestead , 10295 SW 248 St., 25.5434, −80.3573, 8-I-2019, Cocos nucifera, J. Piontek ; 2 larvae, 2 pupae: Homestead, 25.5327, −80.4917, 29-XI-2018, Cocos nucifera, J. Hayden ; 4 larvae: Miami, 3011 NW 18 Terr., 25-VI-1975, Latania sp. , W.S. Brewton, J.T. Loyd; 4 larvae: Miami, 7821 SW 22 St., on Livistona chinensis , 29-VIII-2017, G. Gonzalez, E17-3497, MGCL slide 5577 (larval cuticle) ; 2 pupae: same data ; 2 larvae: Miami, 19600 SW 136 St., on Cocos nucifera , 10-X-2019, H. Carmenate, Y. Perez, MGCL slide 5663 (larval cuticles) ; 5 larvae: Opa-Locka, 17700 NW 19th Ave., 20-I-1987, Latania, L.F. Davis ; Palm Beach Co.: 1 larva, 1 pupa: Boca Raton, 420 NE 35 th St., 6-III-1980, Cocos nucifera, Malayan Palm, M. Sanders, E1980 -1536 ; 1 larva: Lantana, 5367 Second Rd. , 8-VI-1983, Latania lontaroides, R. Buchholz, E1983 -2395 .

Diagnosis. Adult. The second segment of the labial palpus has scattered black scales, more concentrated distally, and a dorsal scale tuft ( Fig. 9 ), whereas the other common species have the palp uniformly gray exteriorly. The third (apical) segment is nearly as long as the second. The antennae are slightly longer than the forewings; they are shorter in H. sabalella . The scape has a pecten, absent in H. sabalella . The forewings are beige with scattered black scales, and the terminal black spots are present but less discrete than in other species ( Fig. 3, 4 ); among the other described species, only H. octagonella (Walsingham) also has scattered black scales. The male hind wing has a hair pencil from the posterior margin at the base that fits underneath the abdominal dorsal scale tuft ( Fig. 16 ). Forewing Rs 2 and Rs 3 are stalked, and M 1 is fused with them, having a weak but distinct base and diverging from Rs 3, or else M 1 is slightly separate and weak ( Fig. 35 ). One of the CuA veins is absent in both the forewing and hind wing. On the male abdomen, tergite 2 narrows posteriad in a Y-shape, and tergite 3 is very narrow and linear ( Fig. 12 ). These two tergites bear lateral tufts of broad brown-gray scales that fold over the hind wing hair pencils. Homaledra sabalella and the species described below have unmodified tergites. Male genitalia: The phallus has a short row of small cornuti ( Fig. 23 ). The apex of the valva is roundly attenuate ( Fig. 18 ). Female genitalia: The corpus bursae is arachiform (peanut-shaped) with a medial constriction ( Fig. 30 ); it is pyriform in H. sabalella . The round, spinose signum is located halfway along the posterior expansion, and the spines are larger on one side than the other ( Fig. 31 ); the signum is similar in H. sabalella , but the species below has a granular field. Larva ( Fig. 39 ). The subventral group on A3–A6 has 5 or rarely 6 setae: three large setae nearer the crochets and two or three small ones proximad on the proleg ( Fig. 42 ). A1 and A2 also have small accessory setae next to SV1, 2, and 3. The other species have fewer SV setae, and all are uniform in size. Pupa ( Fig. 46 ). The antennae and metathoracic legs are longer than the wings and are extended onto the 5 th abdominal segment, in some specimens to the end of the 6 th segment; the antennae are not tangent, being narrowly separated by the legs along the whole length.

Male Homaledra octagonella have abdominal tergites like H. howardi : T2 is triangular, narrowing posteriad, and T3 is a narrow ridge, flanked by enlarged pleural scales ( Fig. 15 ). Homaledra octagonella differs in having white wings with scattered black scales and larger discal and anal spots ( Fig. 49 ); the labial palpus is mostly white, and the second segment has gray lateral scales but without scattered colored scales or a tuft. The size of H. octagonella is much smaller (wing length 4.5–5.0 mm). In the male genitalia of H. octagonella ( Fig. 21 ), the cornuti are not evident ( Fig. 26 ) (MGCL slide 4542). The female has an echinoid signum, about 1/3 from the anterior end of the evenly sack-shaped corpus bursae (USNM slide 86,403, Kirbyville, Texas).

Description. Head ( Fig. 9 ). Haustellum white-scaled; frons cream ventrally, black medially below level of antennae, black overlain by pale yellow scales in fresh specimens; frons dorsally gray and brown with black anterior of antennae; vertex brown; antennal scape dorsally with two dark-gray areas, ventrally cream, with pecten of about six cream-color scales; pedicel not visible, flagellum brown with some dorsal gray scales, longer than wings; ocelli absent; maxillary palpi cream; labial palpi with proximal segment cream, second segment cream with many dark gray ventral scales and few brown scales, scales erect dorsally in loose subapical tuft in both sexes; distal labial segment brown with few gray scales.

Thorax. Prothorax behind head dark gray; rest of thorax brown dorsally, cream ventrally. Prothoracic leg coxa cream, femur cream with gray anterior edge, tibia gray with few cream scales, forming two tufts in subproximal and distal positions; tarsi gray and cream. Mesothoracic leg mostly cream with small gray spot on dorsal side of tibia and one at end of tarsus; one pair of tibial spurs present. Metathoracic leg mostly cream except tibia pale gray along whole dorsal side, with long hairlike scales; two pairs of tibial spurs present. Forewing ( Fig. 3, 4 ) length 6.0–8.0 mm (n = 10), dorsal side brown with irregularly scattered dark gray scales; black spots at end of discal cell and terminal ends of veins present but small, black spot absent from anal fold; edge of costa pale; ventral side gray; fringe brown and gray. Male with chitinous retinacular hook. Forewing venation: Rs 4 and M 1 stalked, the stalk weak and anastomosed with Rs 3 (alternatively Rs 4 stalked with Rs 3, M 1 fused with Rs 4 at length); only one CuA vein present ( Fig. 35 ). Hind wing dorsally and ventrally gray, fringe brown on costa, gray on posterior margin. Female with two frenular bristles; male with one. Male with paired hair pencils of long cream scales arising immediately below base of hind wing ( Fig. 16 ). Hind wing venation: M 1 and M 2 short-stalked or connate; only one CuA vein present.

Abdomen. Dorsal side brownish gray, including enlarged tergal scales of male; ventral side pale brown or dark cream. Tergites I–VII of male ( Fig. 12 ) sclerotized and bearing spines in irregular distribution over entire tergite (not in rows); tergite I of male square with convex lateral margins; tergite II narrowed posteriad with concave margins, bordered by one row of enlarged scales; tergite III evenly narrow, surrounded by irregular scales on membrane and outwardly by a row of enlarged scales; tergites IV–VII approximately square without large scales; tergite VIII membranous. Tergites I–VI of female all square or nearly so, not narrowed, and bearing small spines as in male; tergite VII rectangular but without spines. Eighth abdominal segment of female brownish yellow, pale brown in male.

Male genitalia ( Fig. 18, 23 ). Uncus hooked, subapically enlarged and laterally compressed; gnathos absent; transtilla a pair of narrow sclerotized straps in membrane, meeting mesally; juxta broadly rectangular with ventral concavity; valva elongate, without fibula, setose along ventral half, with low, seta-bearing subcostal ridge and rounded apex; saccus not pronounced; tegumen with sclerotized medial longitudinal ridge. Phallus with sclerotized strap entire length; small cornuti in one small patch on vesica.

Female genitalia ( Fig. 30, 31 ). Ostium bursae without sclerites; colliculum present; ductus seminalis attached to ductus bursae just anteriad of colliculum; ductus bursae with granular texture on one side. Corpus bursae 2 mm in total length, as long as ductus bursae; oblong and arachiform (peanut-shaped) with medial constriction; anterior half smooth and weakly striate; posterior half with granules like those on ductus bursae; one round signum in center of posterior half, with numerous blunt spines in asymmetric arrangement, about three on one side larger than others.

Larva ( Fig. 39, 42, 44 ). SV group on A3–A6 with 5 or rarely 6 setae: 1 large seta anterior of crochets, 2 large setae anterolateral of crochets, and 2–3 small setae lateral and proximad of those.

Etymology. This species is named for Prof. Forrest W. “Bill” Howard, who first discovered the infestations of this species in South Florida and who studied its bionomics extensively.

Distribution. Fig. 59 . Southern Florida, U.S.A. and Dominican Republic.

Host plants. Bismarckia nobilis Hildebr. and H. Wendl. , Cocos nucifera , Corypha umbraculifera L., Corypha sp. , Latania lontaroides (Gaertn.) H.E. Moore , Latania sp. , Livistona chinensis (Jacq.) R. Br. , Sabal palmetto , Sabal sp. , Serenoa repens , Thrinax sp. , Washingtonia robusta , Zombia antillarum (Descourt) L.H. Bailey. Larvae have been collected most often on Cocos , Washingtonia H. Wendl. , and Livistona R. Br. ( Howard 1996) , but the earliest larval lots are from Latania . Because of confusion with other Homaledra species , all records must be confirmed by examination of specimens.

Larval behavior. The larvae live in small groups underneath frass tubes on palm leaves. They are capable of infesting single pinnules of coconut palms ( Fig. 53, 54 ), albeit without tying them together with stronger silk. When on palm leaves that are not pinnate, they make large patches of randomly directed frass tubes like the other species described below ( Fig. 55 ).

Remarks. Male specimens of H. howardi are readily diagnosed by the tufts of large dorsal abdominal scales and the associated thoracic androconia. The abdominal scales are easily overlooked on dried pinned specimens because they are appressed to the body, but they are easily visible in moths collected into alcohol, as they are dilated by abdominal distention. It is likely that the initial determination as H. sabalella was based on dried specimens. The numerous other differences in maculation, venation, female genitalia, and larval chaetotaxy corroborate that it is specifically distinct from H. sabalella . The narrow terga and associated male sex scales are structures shared between H. octagonella , H. howardi , and the undescribed Puerto Rican palm-leaf skeletonizer. The case-bearing, lichenivorous larval behavior of H. octagonella is unique among Homaledra species as far as known.

Examination of preserved larvae show that H. howardi was present in Miami in 1975 and Boca Raton by 1980, two decades before they were noticed by Dr. Howard in Fort Lauderdale. The three early records on Latania palms could reflect host preference, movement of ornamental palms, or accessibility of the foliage for collection; these possibilities are speculative. It is possible that H. “ sabulella ” [sic] identified by Russo (1927) as a pest of coconut and other palms in the Dominican Republic in fact refers to H. howardi . The slide-mounted dissection in the USNM was collected about the same time as Russo’s report. Efforts to search the collections of the Museo Nacional de Historia Natural (Santo Domingo) have been impeded by the current Covid-19 pandemic restrictions.

The mtDNA COI “barcode” sequence is not yet represented by a BIN on BOLD. Sequences for samples E2017-3497 (from which the holotype was chosen) and E2018-4018 are available on GenBank with respective accession numbers MW549054 and MW549055 . The merged sequence of the two is as follows:

TATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCACTTAGTTTATTAATTCGAGCTGAATTAGGAAATCC AGGTTCTTTAATTGGAGATGATCAAATTTATAATACAATTGTAACAGCTCACGCTTTTATTATAATTTTTTTCATAGTTAT ACCCATTATAATTGGAGGTTTTGGAAATTGATTAGTYCCTTTAATACTAGGAGCTCCCGATATAGCTTTCCCCCGAATA AATAATATAAGATTTTGACTTCTTCCCCCTTCATTAACCCTTTTAATTTCAAGAAGAATTGTAGAAAGAGGAGCAGGTA CTGGTTGAACAGTTTATCCTCCTTTATCATCTAATATTGCTCATGGAGGAARATCTGTAGATTTAGCAATTTTTTCTTTA CACTTAGCTGGTATTTCTTCTATTTTAGGGGCAATTAACTTTATTACTACAATTATTAATATACGAATTAATAACATATCT TTTGATCAAATACCCCTATTTGTTTGAGCTGTTGGAATTACTGCTCTTTTATTACTTTTATCTTTACCAGTTCTTGCAGG AGCAATTACTATATTATTAACTGATCGAAATCTTAATACATCATTCTTTGATCCTGCGGGAGGAG

Figures

Figure 59. Distribution in peninsular Florida of H. howardi (red circles) and H. knudsoni (green squares: specimens; yellow triangles: photographs on line).

Figures 1–10. Habitus and heads of Homaledra spp. 1) Homaledra sabalella male (FL, Lake Co.). 2) H. sabalella female (FL, Levy Co.).3) H. howardi holotype male (FL, Miami-Dade Co.). 4) H. howardi female (FL, Miami-Dade Co.). 5) H. knudsoni male (FL, Osceola Co.). 6) H. knudsoni female (FL, Alachua Co.). 7) H. knudsoni holotype male (TX, Cameron Co.). 8) H. sabalella head in lateral aspect (FL, Lake Co.). 9) H. howardi head (FL, Miami-Dade Co.). 10) H. knudsoni head (FL, Alachua Co.). Scales = 5 mm.

Figures 11–26. Male abdominal structures of Homaledra spp. 11–15, cuticle; 16, androconia of hind wings and tergites 2–3; 17–21, male genitalia and phalli; 22–26, cornuti (scales: 0.5 mm). Numbers refer to MGCL slides. 11) H.sabalella (#4257). 12) H. howardi (#3296). 13) H. knudsoni (#4438). 14) H. heptathalama (#4260). 15) H. octagonella (#4542). 16) H. howardi (FL, Miami-Dade Co.).17) H. sabalella (#4257). 18) H. howardi (#3296).19) H. knudsoni (#4438).20) H. heptathalama (#4260).21) H. octagonella (#4542). 22) H. sabalella (#4257). 23) H. howardi (#3296). 24) H. knudsoni (#4580). 25) H. heptathalama (#4260). 26) H. octagonella (#4542). c, cornuti; ps, phallus sclerite; tr, transtilla.

Figures 27–33. Homaledra female genitalia, MGCL slide number given. 27) H. sabalella (#4566). 28) H. sabalella, detail of signum (#4566). 29) H. sabalella, detail of signum (#3303). 30) H. howardi (#4261). 31) H. howardi, detail of signum (#4261). 32) H. knudsoni (#4673). 33) H. knudsoni, detail of signum (#4673). Scale bars = 500 µm.

Figures 34–37. Homaledra wings. MGCL slide number given. 34) H. sabalella (#3321). 35) H. howardi (#3335). 36) H. knudsoni (#5005). 37) H. heptathalama (#5029).

Figures 38–47. Homaledra immature stages.38) H.sabalella, larva.39) H. howardi, larva.40) H. knudsoni, larva.41) H. sabalella, A3 proleg with 3 SV setae. 42) H. howardi, A4 proleg with 3 large and 2 small SV setae. 43) H. knudsoni, A3 proleg with 4 SV setae. 44) Ventral aspect of head of H. howardi showing submental pit (sp). 45) H. sabalella, pupa. 46) H. howardi, pupa. 47) H. knudsoni, pupa. Scales = 100µm.

Figures 48–58. Habitus of other Homaledra species and larval damage. 48) Homaledra heptathalama male (FL, Levy Co., FSCA). 49) H. octagonella male (FL, Putnam Co., FSCA). 50) Damage of H. sabalella on date palm (Phoenix sp.) (FL, Collier Co.). 51) Damage of H. sabalella on Serenoa repens (FL, Lake Co.), with broad frass tunnel. 52) Damage of H. sabalella on Serenoa repens (FL, Levy Co.), dense leaf-tying silk indicated. 53) Damage of H. howardi on Cocos nucifera (FL, Miami-Dade Co.). 54) Detail of same with larva indicated. 55) H. howardi on Livistona chinensis, showing damage on a broad-leaved palm (FL, Miami-Dade Co.). 56) Damage of H. knudsoni on Sabal palmetto (FL, Alachua Co., Gainesville). 57) Same (FL, Alachua Co., Micanopy). 58) Active leading end of frass tunnel (indicated) of H. knudsoni (FL, Alachua Co., Gainesville). Scales = 5 mm.