Holocacista capensis, van Nieukerken, Erik J. & Geertsema, Henk, 2015

van Nieukerken, Erik J. & Geertsema, Henk, 2015, A new leafminer on grapevine and Rhoicissus (Vitaceae) in South Africa within an expanded generic concept of Holocacista (Insecta, Lepidoptera, Heliozelidae), ZooKeys 507, pp. 41-97 : 51-54

Taxon classification Animalia Lepidoptera Heliozelidae

Holocacista capensis sp. n. Figs 1-3, 22, 25, 30, 37-53, 70-82, 94-96, 107-110, 115, 116

Antispila sp. Kroon (1999): 83, 120 [on Vitis sp.].

Type material.

Holotype male, South Africa (Western Cape), Paarl NW, De Heuvel estate, 180 m, 16.i.2013, leafmines on Vitis vinifera cv ‘Regal’, EvN2013004, emerged 27.i.2013, E.J. van Nieukerken & H. Geertsema, Genitalia slide EvN4622, DNA extracted (RMNH.INS.24622) (RMNH).

Differential diagnosis.

Externally Holocacista capensis is almost inseparable from other South African Vitaceae -feeding Holocacista species, including Holocacista salutans . Absence or reduction of the first costal spot in the male, however, may be an indication that the specimen might be Holocacista capensis ; only study of genitalia allows a firm identification. For differences with Holocacista varii , see there. The only South African Vitaceae -feeding “real” Antispila species is much larger and has more antennal segments (ca. 26). In male genitalia the configuration of the small number of spines on phallocrypt in combination with the ventrally curved phallus appendix is characteristic, otherwise very similar to Holocacista salutans and some of the unnamed Rhoicissus miners. Leafmines characterised by the very contorted first part of the mine, which is straighter or shorter in the other species; currently the only known leafminer on Vitis in South Africa.

Description.

Male (Figs 1, 3). Head face and vertex covered with appressed, metallic, silvery-white scales, more brownish grey on vertex. Palpi porrect, white; base of proboscis covered with white scales. Antenna with 16 segments, ringed, each flagellomere with a basal fuscous scale ring and apical white scale ring on upper side, scales on underside all white. Legs grey, tarsi mostly yellowish white, especially on underside. Thorax and forewings ground colour grey brown, slightly irrorate, caused by scales being dark tipped and paler at base. A silver-white pattern on forewing consists of a triangular dorsal spot at 1/4, usually associated with a minor spot of just a few scales at costa, that may be joined to dorsal spot, or even completely absent; a second triangular dorsal spot at 1/2, reaching almost to middle of wing; a triangular costal spot just beyond middle, always separate; fringe line very distinct, demarcated by dark-tipped scales. Terminal fringe silvery white. Hindwings pale grey. Underside of wings fuscous, with white spots visible. Abdomen lead coloured, including vestiture on external genitalia.

Female (Fig. 2). Antenna with 16 segments. Colour pattern distinct from male: scales almost uniformly dark fuscous with purplish tinge, resulting in darker, velvety wing colour and contrasting silvery-white pattern; first costal and dorsal spots joined to form a narrow fascia, wider at dorsum; second dorsal and costal spots as in male; fringe line distinct, scales forming cilia line with slightly paler bases. Abdomen almost black, narrowly pointed posteriorly.

Measurements. Male: forewing length 1.8-2.3 mm (2.0 ± 0.1, 20) (1 dwarf of 1.55 mm forewing length excluded), wingspan: 3.9-4.9 mm. Female: forewing length 1.9-2.1 mm (2.0 ± 0.1, 14), wingspan 4.0-4.6 mm.

Male genitalia (Figs 37-49, 94-96, 107-110, 115). Total length vinculum + tegumen 425-625 µm. Vinculum (S IX) long, reaching anterior margin of segment VI. Tegumen (Figs 41, 46, 110) well sclerotised, with medial, slightly-bilobed posterior projection, one sensilla on each lobe; tegumen dorsally with groups of microtrichia, and two lateral lobes with setae or sensilla; a poorly-sclerotised structure below tegumen may be a reduced uncus. Valva (Figs 40, 43, 108) narrow, apex blunt, with stalked pectinifer halfway to inner margin, pecten comprising 8-11 blunt sensilla, usually same number on both valvae, but sometimes a difference of one. Valva length (without transtilla) 200-230 µm. Transtilla (Figs 41, 109) with long sublateral processes and medial spatulate posterior process, with rounded corners. Juxta elongate, as a narrow ventral process of phallus, attached on phallus near phallocrypt spines (Fig. 48). Phallus (Figs 39, 42, 44, 45, 48, 49, 94-96, 107) long and narrow, ca. 340-425 µm long. Phallocrypt (manica) with some strongly-sclerotised conical spines, arranged asymmetrically; in lateral view (Figs 44, 94-96) one dorsally, curved ventrad, a similar strong one ventrally curved dorsad, latter with 3-4 smaller spines in a row anteriorly; in ventrally mounted specimens spines appear mostly on right side, where phallus is constricted. Phallus outer tube with ventrally-curved appendix ca.103-150 µm long (measured along curve).

Female genitalia (Figs 50-53). Length of anterior apophyses 800-900 μm (n=5), posterior apophyses 880-935 μm (n=5). Oviscapt with 5-6 cusps on either side (Figs 51, 52). Ductus spermathecae with many wide convolutions, spermathecal papilla with circle-shaped sclerotisation (Fig. 50).

Biology.

Host plants. Vitaceae : Rhoicissus digitata (L.f.) Gilg. & M. Brandt and various South African grown cultivars of Vitis vinifera (e.g., Chardonnay, Chenin Blanc, Red Globe, Régal).

Leafmines (Figs 70-75, 79). The egg is inserted on the leaf underside, usually within 1-2 mm from a vein, rarely slightly farther. Freshly expanded foliage is preferentially selected for oviposition, but as egg laying proceeds from early spring to late autumn, it also oviposits on older leaves, even those showing previous feeding. The majority of the mines on Vitis (75% of 160 mines from six samples) start at the leaf edge, but even there the egg is always near the vein in the tip of a lobe; some mines originate close to the leaf midrib. Also, the few studied mines on Rhoicissus start at the leaf(let) tip. The mine starts as a much contorted narrow gallery, often first in a zigzag pattern with U-turns, eventually enlarging into an irregular wide gallery or a blotch. The frass is brown in the early mine, later black, in a rather thin line in the centre of the gallery; later the frass is in clumps in a wider central line. The whole mine occupies a small area of ca. 12-15 mm long, of which the size depends on leaf thickness; in thin leaves mines are appreciably longer and wider. Mines are very often clustered in groups of 3-5 or even more. The larva cuts out an elliptic case of about 2.5-4.1 mm (3.4 ± 0.3, n=34) × 1.5-3.1 mm (2.3 ± 0.3, n=34) mm wide, ratio 1.2-1.8 (1.5 ± 0.1).

Voltinism and habits.

The moth is multivoltine; the first adults appear during early spring (September to October) and a single generation lasts from three to four weeks; peak numbers are reached during February and March at the height of the grape picking season. Moths are still present in April; the last were seen early May; many cocoons overwinter in leaf litter, dropping to the ground and pupating amongst leaf litter or attached to stems and trellises from April onwards, and yielding moths from September onwards. Larvae are present almost continuously from November to early May when the leaves start to wither and drop. Larvae have only once been collected on Rhoicissus , these in March. When fully grown, larvae descend from the mines to attach their cocoons upon landing on a variety of objects such as other leaves, berries of grape bunches, trellises or on the bark of the vine itself (Fig. 76).

Moths aggregate and mate in the heat of the day (1100-1400 hrs) on exposed vine foliage, but prefer to oviposit in the shaded canopy conditions under which table grapes are grown; wine grapes, grown in an open cultivation system and fully exposed to the sun are rarely, or at least less seriously attacked.

Distribution

(Fig. 115). On native Rhoicissus as yet only found once: South Africa, Western Cape (Wilderness). On cultivated Vitis from South Africa: Western Cape, Northern Cape and Gauteng.

DNA barcode.

We barcoded eight specimens, including the Holotype. All barcodes belong to Barcode Identification Number (BIN):ACG9027, the largest intraspecific distance is 1.4%, between one specimen collected in Gauteng and the rest, collected in the Western Cape.

DNA-Barcode of Holotype, HELA103-14 (658 basepairs):

AACTTTATATTTTATTTTTGGTATTTGAGCGGGATTAGTAGGAACATCAATAAGTTTATTAATTCGTGCTGAATTAGGAATCCCTGGGTCCTTAATTTCTAATGATCAAATTTATAATACTATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCGTTAATATTAGGAGCCCCAGATATAGCATTTCCTCGTCTTAATAATATAAGTTTTTGACTCCTTCCCCCATCTTTAACATTATTAATTTCAAGAAGATTAGTTGAAATGGGATCAGGAACTGGATGAACTGTCTATCCACCTTTATCTTCCAATATTGCCCATATGGGAACTTCTGTGGATTTAACTATTTTTTCTTTACATTTGGCTGGAATTTCATCTATTTTAGGAGCTGTAAATTTTATTACAACAATTATTAATATAAAACCAGTTAGAATAATATATAATCAACTTTCTTTATTTGTTTGATCTGTGGGTATTACAGCTTTATTACTATTATTATCTTTACCTGTATTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTTCTTTTTTTGACCCTATGGGAGGAGGAGACCCTATTCTATATCAACATTTATTT

Remarks.

The only wild Rhoicissus on which mines of Holocacista capensis were collected, was identified by Vári in his notebook as Rhoicissus revoilii . The single leaf we studied could belong to this species or to Rhoicissus digitata , which is very similar. On the basis of the distribution ( Palgrave and Palgrave 2002), we conclude that the latter is the most likely, since Rhoicissus revoilii is not known to occur in the Western Cape.

Several reared adults were used in 2013 for a rearing experiment on potted plants of Rhoicissus rhomboidea (E.Mey. ex Harv.) Planch., bought in the Netherlands. Although the adults lived for several days, no traces of mines were found. Either the species is unsuitable as a hostplant, or these potted plants contained remnants of insecticides. Later, we were more successful with rearing larval offspring from Vitis -grown adults from Wellington on potted Rhoicissus digitata in the laboratory in Stellenbosch (for resulting leafmines see Fig. 79). The main aim of this preliminary study was to detect whether moths reared on Vitis vinifera would readily breed on (caged) Rhoicissus digitata ; moths emerging from grapevine leaf litter or sampled foliage were released into the caged Rhoicissus . The latter was readily infested, often resulting in the entire leaf being consumed by the larvae.

Other live cocoons were sent in 2013 to Lund, Sweden, emerged there, and have been used for pheromone studies ( Wang et al. 2015).

Material examined.

Adults and leafmines: South Africa, Gauteng: 3♂, Pretoria, Roodeplaat, 1245 m, leafmines Vitis vinifera , emerged 10-12.x.1990, S. Marais, Genitalia slide EvN4264, DNA extracted (RMNH.INS.24264) (HG, RMNH); 3♂, 5♀, same locality, emerged 4-14.iv.2012, D. Visser (HG, RMNH); 2♀ [5 more specimens in TMSA], Pretoria, emerged 2-6.xi.1950, L. Vári, Genitalia slide TM6830, Wing slide TM 2414 (TMSA); 1♀ [1 more specimen in TMSA], 1 herbarium sheet with 6 leafmines on 4 leaves, Pretoria, 8.iii.1953, Ac. no. 660, leafmines on Vitis vinifera , emerged 10-31.iii.1953, L. Vári (TMSA); 1♂, 1♀, 1 herbarium sheet with ca. 13 leafmines in 4 leaves, Pretoria, in own garden, 21.x.1953, Ac. no. 866, leafmines on Vitis vinifera , emerged 26. x– 3.xi.1953, L. Vári (TMSA); 1♂, larvae and leafmines, Roodeplaat exp. Farm, 1168 m, 23.i.2013, leafmines Vitis vinifera , EvN2013025-026, E.J. van Nieukerken & S. Richter, 1 larva DNA extracted (RMNH.INS.29586). Northern Cape: 9♂, 14♀ [unmounted], Vaalhartz Research Stn., Jan Kempdorp near Kimberly, 27.ii.1980 [emergence date?], W. v.d. Westhuyzen (TMSA). Western Cape: 2♂, 3♀, Cape Town, Woodstock, cocoons collected on Vitis vinifera , 26.ii.2012, emerged 5-13.iii.2012, M. Wohlfarter; 1♂, Oudtshoorn, March 1998, on urban vine, H. Geertsema (HG); 81♂, 58♀, Paarl, nr Windmeul, 168 m, leafmines/cocoons on Vitis vinifera , emerged 1. ii– 30.iii.2012, H. Geertsema, Genitalia slides EvN4260♂, 4261♀, 4262♂, 4263♀; complete adults on slide EvN4445♂, 4446♂, 4447♂, DNA extracted (RMNH.INS.24260, 24261, 24262, 24263, 24445, 24446, 24447) (HG, RMNH); 3♂, 2♀, Paarl NW, Nelson estate, 125 m, 15.i.2013, leafmines on Vitis vinifera cv 'Chenin Blanc’, EvN2013002, emerged 18. i– 1.ii.2013, E.J. van Nieukerken & H. Geertsema; 6♂, 10♀, 4 larvae, ibidem, 130 m, leafmines on Vitis vinifera cv ‘’Chardonnay’, EvN2013003, emerged 24. i– 5.ii.2013, Genitalia slide EvN4624♀, DNA extracted (RMNH.INS.24624), larvae RMNH.INS.2956265; 6♂, 11♀, 6 larvae, Paarl NW, De Heuvel estate, 180 m, 16.i.2013, leafmines on Vitis vinifera cv ‘Regal’, EvN2013004, emerged 20-27.i.2013, E.J. van Nieukerken & H. Geertsema, larvae RMNH.INS.29578-83; 2♂, 3♀, ibidem, leafmines on Vitis vinifera cv 'Red globe’, EvN2013005, emerged 26. i– 4.ii.2013; 1♂, 3♀, ibidem, 25.i.2013, leafmines on Vitis vinifera cv 'Red globe’, EvN2013030, emerged 1-6.ii.2013, E.J. van Nieukerken & H. Geertsema (RMNH, HG); 5 adults, Somerset, 23.ii.2012, cocoons collected on Vitis vinifera , emerged 27. ii– 5.iii.2012, O. Lotter; 1♀, Wellington, emerged 25.xii.2014, leafmines on Vitis vinifera , L. Torrance (HG). 3♂, 1♀ [8 more specimens in TMSA], 1 leaf with 6 mines, Wilderness, Kaaimans River, 15.iii.1954, Ac. no. 1093, leafmines on Rhoicissus digitata [in notebook Vári as Rhoicissus revoilii ], emerged 4-5.iv.1954, L. Vári, Genitalia slide EvN4381♂, DNA extracted (RMNH.INS.24381) (TMSA).

Additional data

[leafmines and larvae collected, no adults kept in collection]. South Africa, Western Cape: 11♂, 21♀ [reared from 50 cocoons in Lund, Sweden and used for pheromone studies], Paarl NW, De Heuvel estate, 180 m, 25.i.2013, leafmines on Vitis vinifera cv ‘Regal’, EvN2013029, emerged 2-15.ii.2013, E.J. van Nieukerken & H. Geertsema; several adults, Wellington, emerged xii.2014, ex Vitis vinifera laboratory bred on Rhoicissus digitata , L. Torrance (HG).