Hermeuptychia intricata Grishin

Cong, Qian & Grishin, Nick V., 2014, A new Hermeuptychia (Lepidoptera, Nymphalidae, Satyrinae) is sympatric and synchronic with H. sosybius in southeast US coastal plains, while another new Hermeuptychia species - not hermes - inhabits south Texas and northeast Mexico, ZooKeys 379, pp. 43-91 : 55-59

Hermeuptychia intricata Grishin sp. n. Figs 22-35, 40-43, 60c, f, i, l, 61a, 62n, 64 i–p, 65 part, 66 part, 67 part, 68 part

Description.

Male (n = 14, Figs 22-23, 28-29, 32, 34-35, 40-43, 68 part) - holotype forewing length = 16.5 mm. Forewing triangular, rounded at apex and tornus, costal and outer margins convex, inner margin almost straight, mildly concave mediad, two discal cell veins bulged at bases, vein 2A thickened basad. Hindwing rounded, almost circular. Wings dorsally dark-brown with sparse olive-beige overscaling and two darker-brown terminal lines. Wings ventrally pale-brown, paler towards inner margin of forewing, with extensive beige overscaling, particularly along veins in distal part in some specimens; submedial and postmedial dark-brown lines and dark-brown end-of-cell streak (smaller on hindwing) between them; forewing postmedial line bent basad near costa in many specimens; hindwing postmedial line almost straight near costa, rarely convex basad and typically convex distad posterior of M3 (between the two small eyespots in the middle, closer to posterior eyespot); two terminal dark-brown evenly curved marginal lines, dark-brown sinuous submarginal line, and row of submarginal eyespots basad of the sinuous line and posteriad of outer discal line, largest eyespots black-centered and pupiled with pale-blue scales: on forewing, largest eyespot in cell M1-M2, eyespot in cell R5-M1 black-centered in some specimens; on hindwing, largest eyespots in cells Cu1-Cu2 and M1-M2, a smaller one in cell Cu2-1A+2A, even smaller, but still black-centered and pale-blue pupilled in cell Rs-M1, and two smallest, usually without black, but in some specimens pale-blue pupilled eyespots in cells M2-M3 and M3-Cu1. Fringes monochrome, a little paler than the ground color of wings. Head, palpi, thorax and abdomen dark-brown above, paler and mostly beige beneath. Antennae dark-brown above with pale scales at segments, orange-brown at the club, beneath beige basad, orange-brown in distal half. Legs brown with beige scales. Male genitalia (n = 14: 12 dissected, 2 inspected in situ, Figs 60c, f, i, l, 61a, 62n) - typical for the genus, smaller and darker in color (more sclerotized) than those of Hermeuptychia sosybius . Tegumen dome-like, rounded at margins. Uncus leaf-shaped in dorsal view, angled to the sides, roof-like, convex distally but almost flat basally in lateral view, without thin, membranous carina in basal half; apex of uncus pointed, not truncated. Gnathos arms thin, wide apart, divergent, about the same length as uncus. Valvae narrow, elongated with thin cuculli extending past gnathos not farther than a third of their length; cucullus more rounded at apex, usually with a couple of small teeth; cucullus ventrally with inner medial bulge. Saccus about the same length as cucullus, narrow. Aedeagus elongated, almost straight, only slightly and evenly curved, not bent, broader and shorter compared to Hermeuptychia sosybius , with a smaller, about as long as wide phallobase. Female (n = 8, Figs 23-27, 30-31, 33, 68 part) - similar to male in facies, with slightly more rounded wings and dorsally paler in color. Female genitalia (n = 8, Fig. 64 i–p) with antrum darker in color and smaller than that of Hermeuptychia sosybius . Ostium bursae ellipsoidal, its ventral margin longer than dorsal margin. Antrum narrower anteriad, almost triangular in ventral view, somewhat kidney-shaped in lateral view, mostly symmetric. Ductus and corpus bursae each in length similar to antrum; corpus bursae with two signa, spines in a signum broad, leaf-shaped, usually shingled in two rows.

Barcode sequence of the holotype.

Genbank accession KJ025595, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAATTGGTACATCATTAAGTTTAATTATCCGAATAGAATTAGGTAATCCAGGATTTTTAATTGGAGATGACCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCCATTATAATTGGAGGATTTGGTAATTGACTTGTCCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGTATAAATAATATAAGATTTTGATTATTACCCCCATCTTTAATTTTATTAATTTCTAGTAGTATTGTAGAAAATGGAAGTGGGACAGGATGAACAGTTTACCCCCCCCTCTCATCTAATATTGCTCATAGAGGTTCTTCAGTAGATTTAACAATTTTTTCACTTCATTTAGCTGGAATTTCTTCAATCTTAGGAGCTATTAATTTTATTACAACAATTATTAACATACGAATCAATAATATATCTTATGATCAAATACCTTTATTTATTTGAGCTGTAGGAATTACAGCTCTTCTTTTACTTCTTTCATTACCTGTTTTAGCAGGAGCTATTACTATACTTCTTACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

In addition to the holotype, barcodes and ID tags were obtained for 19 paratypes (15 full-length barcodes and 4 ID tags, see Table 1, GenBank accessions: KJ025588-KJ025607, except KJ025595, which is the holotype). Full length barcodes revealed five haplotypes differing from each other by just 1 to 3 base pairs (less than 0.5%). The haplotype of the holotype was more frequently observed (Fig. 66b) and other four haplotypes were confined to a single specimen in the sample.

Type material.

Holotype: ♂, has the following four rectangular labels: white printed - || USA: TEXAS: Fort Bend Co. | Brazos Bend State Park, | Hale Lake, 29.3801°, -95.5847° | 17-Aug-2013 Grishin N.V. ||; white printed - || DNA extraction | NVG-1560 | 2013-09-05 ||; white printed - || Genitalia vial # | NVG130927-14 | Prep. N. V. Grishin ||; red printed - || HOLOTYPE ♂ | Hermeuptychia | intricata Grishin ||. The holotype is illustrated in Figs 22-23, 60c, f, i, l, & 68 (first image), and the Genbank accession for its DNA COI barcode sequence is KJ025595. Upon publication, the holotype will be deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC (USNM). Paratypes: 13 ♂♂ and 8 ♀♀, all from USA. Of these, 2 ♂♂ and 5 ♀♀ with the same data as the holotype; and 3 ♂♂ (DNA vouchers: NVG-1541, NVG-1548, & NVG-1551) from 2.5 km to the east, i.e. USA: Texas: Fort Bend Co., Brazos Bend State Park, Horseshoe Lake trail, latitude 29°22'54.96", longitude -95°36'41.06", elevation 15 m, 17-Aug-2013, leg. N. V. Grishin. Sexes and GenBank accessions|DNA voucher numbers|genitalia codes (na if not available) for these paratypes (the same format is used below for others) are: ♂ KJ025588|NVG-1541|NVG131003-03, ♂ KJ025589|NVG-1548|na, ♂ KJ025590|NVG-1551|na, ♀ KJ025591|NVG-1554|NVG130927-07, ♂ KJ025592|NVG-1555|NVG131003-04, ♂ KJ025593|NVG-1556|NVG131003-05, ♀ KJ025594|NVG-1558|NVG130927-08, ♀ KJ025596|NVG-1563|NVG130927-11, ♀ KJ025597|NVG-1565|NVG130927-12, ♀ na|na|NVG131003-10. All but one of these paratypes are illustrated in Figs 24, 25, 68 (above the line). 1 ♂ Texas: Brazoria Co., Bar-X Ranch, Rd. 971N, 29.13252, -95.58340, 7 m, 4-Mar-2000, leg. Nick V. Grishin, KJ025599|NVG-1631|NVG131017-08 (Figs 28-29, 62n). 1 ♀ Texas: San Jacinto Co., Sam Houston National Forest, USF217 @ Big Creek, 58 m, 12-Apr-1998, leg. Nick V. Grishin, KJ025598|NVG-1629|NVG131017-06 (Figs 30-31). 1 ♂ South Carolina: Charleston Co., McClellanville, Wedge Plantation, 6-Apr-1970, leg. D. C. Ferguson, KJ025600|13385G07|NVG131102-38 (Fig. 34). 1 ♀ South Carolina: Clarendon Co., 9-Aug-1898, KJ025604|13385G08|NVG131102-39 (Fig. 33). 1 ♀ ibid., Aug-1910, KJ025605|13385G09|NVG131102-40 (Figs 26-27). 1 ♂ ibid., Aug-1910, KJ025606|13385G11|NVG131102-42 (Fig. 32). 1 ♂ Florida: "Putnam Co | Shell Bluff Landing", 29-Sep-1985, George Balogh, KJ025602|13385H02|NVG131102-45 (Fig. 40). 1 ♂ Florida: Alachua Co., Gainesville, 12-Mar-1983, leg. Scott W. Gross, KJ025601|13385H01|NVG131102-44 (Fig. 41). 1 ♂ Louisiana: Jefferson Parish, Harahan, 28-Jun-1944, W. D. Field, KJ025603|13386A03|NVG131102-57 (Fig. 43). 1 ♂ Louisiana: Jackson Parish, Jonesboro, na|13386A05|NVG131102-59 (Fig. 42). 1 ♂ "Flatbush LI" (specimen curated in the USNM among Hermeuptychia from Louisiana), collected prior to 1941, G. P. Engelhardt Coll., KJ025607|13386A02|NVG131102-56 (Fig. 35).

Type locality.

USA: Texas: Fort Bend Co., Brazos Bend State Park, near Hale Lake, latitude 29°22'48.27", longitude −95°35'05.02", elevation 16 m. This locality is by a wooded, partly open, lowland hiking trail (near and along the park paved road) from a parking lot towards the Big Creek, north of the Hale Lake.

Etymology.

The name refers to the difficulty in recognizing this very distinct species and its intricate ventral wing patterns. The name is an adjective.

Distribution.

Generally, this is a species of eastern US coastal plains and is currently documented from Texas, Louisiana, Florida, and South Carolina (Fig. 67). It is expected to be more widely distributed in the region and the exact boundaries of the range remain to be investigated. For instance, photographs of live individuals from Alabama: Bibb Co., Blue Girth Creek, 08-VIII-2004 & 18-VI-2005 by Vitaly Charny ( Warren et al. 2013, specimens not collected, excluded from the type series) exhibit characters more consistent with Hermeuptychia intricata than with Hermeuptychia sosybius (see discussion below). Furthermore, it is difficult to interpret the locality label for the last listed paratype other than "Flatbush Long Island" [New York, Kings Co.]. However, Hermeuptychia has not been recorded that far north–northernmost records are from southern New Jersey and southern Pennsylvania ( Opler et al. 2013)-therefore this specimen might have been mislabeled. Nevertheless, searches for this species in the coastal New York/New Jersey area might be interesting to probe its northern distribution limits. An additional specimen (not examined, excluded from the type series) from Costa Rica: Puntarenas Province, GenBank accession AY508548 ( Murray and Prowell 2005) has DNA sequence with only 1 bp difference (over 435 base pair C-terminal segment of the barcode) from the USA Hermeuptychia intricata barcodes. Unless this sequence is a contamination, it is possible that the Costa Rican specimen is Hermeuptychia intricata , which may be ranging southwards at least to Costa Rica. It is apparent, however, that Hermeuptychia intricata is either more restricted in distribution and local, or significantly less common than Hermeuptychia sosybius , because several dozen available barcode sequences of Hermeuptychia specimens from different parts of the range in east US (NC, TN, FL, LA, OK and TX, see Fig. 66b) clearly group with Hermeuptychia sosybius , and a sample of 177 genitalically inspected Hermeuptychia specimens from 13 US states (MD, VA, SC, GA, TN, AR, AL, KY, MS, LA, TX & FL) in the USNM yielded only 8 Hermeuptychia intricata (less than 5%). We hope that a timely description of this species within a few months after its initial discovery will stimulate further studies of this interesting cryptic-in-facies butterfly, which, however, can be easily distinguished from its more common congener by genitalia (Figs 60a, c, d, f, g, i, j, l, 61a, c, 62 n–z 2 & 64 a–p) and DNA barcodes (Fig. 66). All known Hermeuptychia sosybius records should be scrutinized in search for Hermeuptychia intricata .

Diagnosis.

In wing pattern, the new species is very similar to Hermeuptychia sosybius . We were not able to find solid diagnostic characters for the new species, and only hypothetical field marks could be suggested (see discussion). However, it could be easily identified by many distinctive characters of genitalia.

Males of the new species possess: (1) smaller and more robust and darker genital capsule, even in males with larger body size (Fig. 60c)-genitalia of Hermeuptychia sosybius from various parts of the range are larger and look “wider” and are paler (Fig. 60a); (2) narrower and apically pointed uncus (Fig. 60c, f)-uncus of Hermeuptychia sosybius is wider and appears truncated at the apex in dorsal or ventral views (Fig. 60a, d); (3) uncus that is more angled to the sides along the dorsal “rim”, thus appearing “higher” in lateral view (Fig. 60l), but flatter basally due to the lack of prominent carina, vs. a dorsally flatter uncus in distal half, with a well-developed thin, membranous carina in basal half in Hermeuptychia sosybius (Fig. 60j); (4) shorter and stouter cucullus, which projects for less than a third of its length farther than the distal ends of gnathos arms (lateral view, Fig. 60i, l)-cucullus in Hermeuptychia sosybius is more gracile, narrower and longer, it projects for close to half of its length farther than the distal end of gnathos (lateral view, Fig. 60g, j); (5) cucullus more rounded at the apex, usually with a couple of barely defined, very small apical teeth, vs. three to five (mostly four) larger teeth in Hermeuptychia sosybius ; (6) interior surface of cucullus ventrally with a more prominent bulge, best seen in ventral view (Fig. 60f vs. 60d); (7) more stout, thicker and shorter penis, best seen in ventral view (Fig. 60f)-penis is more gracile, narrower and longer, especially near the distal end, in Hermeuptychia sosybius (Fig. 60d); (8) shorter phallobase, which is about as long as wide (Fig. 60i, l), vs. phallobase that is much longer than wide in Hermeuptychia sosybius (Fig. 60g, j); (9) smaller and narrower saccus (Fig. 60f), vs. larger and wider one in Hermeuptychia sosybius (Fig. 60d); (10) more obtuse angle formed by the tegumen and vinculum in lateral view (Fig. 60l), vs. typically more acute angle in Hermeuptychia sosybius (Fig. 60j).

Females of the new species possess: (I) narrower ostium bursae and smaller, darker antrum (Fig. 64i, j)-ostium bursae and antrum are larger and antrum is paler in color in Hermeuptychia sosybius (Fig. 64a, b); (II) ventral margin of ostium bursae that extends farther back than its dorsal margin (Fig. 64k, l)-dorsal margin extends posterior of ventral margin in Hermeuptychia sosybius (Fig. 64a, b); (III) antrum that is narrower anteriad, almost triangular in ventral view and symmetric (Fig. 64k, m), vs. rounder, cup-like, slightly asymmetric to the left antrum in Hermeuptychia sosybius (Fig. 64e); (IV) more bent antrum, kidney-shaped in lateral view (Fig. 64n), than that of Hermeuptychia sosybius (Fig. 64j); (V) signa composed of wider, more flattened and rounder spines, mostly in two rows, vs. narrower spines in three to five irregular rows in Hermeuptychia sosybius .

Characters (2) and (3) in males (more pointed apex of uncus and uncus more angled to the sides from the central “rim”) seem to be the easiest to examine without full dissection by brushing the scales off the abdomen tip, even in dry specimens (Fig. 62a, c). Identification of dry females might be more problematic due to abdomen shriveling, however, in freshly caught individuals, ostium bursae and antrum can be easily exposed by squeezing the abdomen in distal third, and the character (II) becomes observable (relative position of ostium bursae margins). Due to these very significant and easily observed differences in genitalia, identification in the field immediately after capture is expected to be straightforward, however, more work remains to be done to discover diagnostic wing pattern characters.

DNA barcodes, consistently with genitalia, set the new species far apart from sympatric Hermeuptychia sosybius , and the difference is about 3.5%, which is significantly higher than "a clear threshold for intra- and interspecific mean distances around 2%", as quoted from the recent comprehensive analysis of Hermeuptychia ( Seraphim et al. 2014).

While the discovery of this second (and new) Hermeuptychia species in eastern USA was very unexpected to us, the next finding is less surprising, although also interesting. Our analysis of DNA barcodes of Texas Hermeuptychia revealed that populations from the lower Rio Grande Valley region of Texas (Webb, Zapata, Starr, Hidalgo, and Cameron Counties) form a tight cluster differing by at least 2% from closely clustered barcodes (divergence average 0.09%, standard deviation 0.19%, maximum below 1%) of over 50 Hermeuptychia sosybius specimens across its range from North Carolina to Texas (south to Uvalde, Comal, Guadalupe and Brazoria Counties, Figs 66-67). These south Texas (and northeast Mexico) Hermeuptychia populations are phenotypically characterized by smaller and more uniformly sized eyespots and more undulated brown lines. This butterfly has been called " Hermeuptychia hermes " in some of the recent literature that advocates the presence of two Hermeuptychia species in the US ( Miller and Brown 1981, brief comment in Neck 1996, Pelham 2008, Warren et al. 2013). However, DNA barcodes clearly and confidently group these populations with Hermeuptychia sosybius (Fig. 66a, bootstrap support above 80%, about 2% sequence difference), and Hermeuptychia hermes sequences are more than 4% different from either of these [Fig. 66a and Seraphim et al. (2014)]. According to DNA barcodes, Hermeuptychia hermes - type locality Brazil: Rio de Janeiro - is in a different species group and clusters with Hermeuptychia maimoune (A. Butler, 1870) rather than with Hermeuptychia sosybius (Fig. 66a). Analysis of male genitalia agrees with this conclusion. Indeed, genitalia of south Texas specimens are clearly from the morphogroup 4 (i.e. Hermeuptychia sosybius ) possessing all the characters specified by Seraphim et al. (2014) and are very different from those of Hermeuptychia hermes [see Forster (1964) and Seraphim et al. (2014) for illustrations]. Most obviously, Hermeuptychia hermes has much longer saccus compared to shorter and more constricted in the middle valvae. Nevertheless, in addition to at least 2% different barcodes, south Texas morphogroup 4 populations differ from eastern Hermeuptychia sosybius in facies to the extent that researchers have been treating them as a species distinct from Hermeuptychia sosybius ( Miller and Brown 1981, Pelham 2008, Warren et al. 2013). Our analysis agrees with this conclusion. Furthermore, we find subtle, but quantifiable, differences in male genitalia between Hermeuptychia sosybius and south Texas Hermeuptychia populations. Evidence presented above suggests that the name Hermeuptychia hermes should not be applied to them. Since currently there are no named species in the Hermeuptychia sosybius group [i.e., molecular group G and morphogroup 4 of Seraphim et al. (2014)] other than Hermeuptychia sosybius , and south Texas populations fall confidently in the Hermeuptychia sosybius group (Fig. 66a), they represent an unnamed species that is described here.