Gubrus lubens Grishin, 2023

Zhang, Jing, Cong, Qian & Grishin, Nick V., 2023, Supplementary Materials and Appendix, Insecta Mundi 2023 (26), pp. 1-115 : 75

Gubrus lubens Grishin , new species

https://zoobank.org/ AEEFAD08-1F9A-406F-8AD7-AD386BBA716D

( Fig. 7 part, 183–184, 418–420)

Definition and diagnosis. Phylogenetic trees reveal that a specimen from Loja, Ecuador, placed in the USNM collection among possible new species of “ Vehilius ” is a distant sister of Gubrus lugubris (Lindsey, 1925) (type locality in Peru) that was previously in the genus Vehilius Godman, 1900 (type species Cobalus illudens Mabille, 1891 , a subspecies of Pamphila stictomenes Butler, 1877 ) ( Fig. 7): e.g., their COI barcodes differ by 10.8% (71 bp), a large divergence likely caused by an elevated evolutionary rate in this lineage and its sister genus Callimormus Scudder, 1872 (type species Callimormus juventus Scudder, 1872 ), and therefore represents a new species in the previously monotypic genus Gubrus . This new species is distinct in its appearance and is recognized among small brown Hesperiidae by rounder hindwing, without produced tornus in males, uniformly colored wings without paler veins and on the forewing with three pale-yellow spots in a line near the bases of forewing cells CuA 1 - CuA 2, M 3 -CuA 1, and M 2 -M 3 and a small paler area instead of a developed spot in cell R 5 -M 1; fringes are paler and indistinctly checkered. This species is not cryptic and is diagnosed reliably by phenotype. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly349.39.4:A117G, aly824.21.1:T348C, aly824.21.1:G351C, aly770.22.2:T84G, aly770.22.2:T120C, aly536.107.1:A129A (not C), aly536.107.1:G135G (not A), aly595.10.1:G801G (not A), aly9855.3.1:C140C (not T), aly1405.20.4:T18T (not C), and COI barcode: T22G, A79C, A379G, A529C, T619A.

Barcode sequence of the holotype. Sample NVG-19019B12, GenBank OR837706, 658 base pairs: AACTTTATATTTTATTTTTGGGATTTGAGCAGGAATATTAGGAACTTCATTAAGATTATTAATTCGTACAGAATTAGGCAATCCTGGATCTTTAATT GGGGATGACCAAATTTATAATACTATTGTTACAGCCCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGTTTTGGTAATT GATTAGTCCCTTTAATACTAGGAGCCCCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGAATATTGCCCCCCTCACTAATATTATTAAT TTCTAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACAGTTTATCCCCCTCTTTCTTCTAATATTGCCCATCAAGGTTCATCGGTTGATTTA GCAATTTTTTCCCTTCATTTAGCAGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACTACTATCATTAACATACGAATTAAAAATCTTTCAT TTGATCAAATACCTTTATTTGTTTGATCAGTAGGTATTACAGCCTTACTTTTACTTTTATCTTTACCAGTATTAGCTGGAGCTATTACTATACTTCT AACAGATCGAAATTTAAATACTTCTTTTTTTGATCCAGCTGGAGGAGGTGACCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History , Smithsonian Institution,

Washington, DC, USA ( USNM), illustrated in Fig. 183–184, bears the following six rectangular labels, five white: [ ECUADOR Loja | Loja-Catamayo Rd. | Km 28 1800m | 16 May ’88 | S. S. Nicolay], [♂ genitalia | slide/vial # | H989 | Prep. S.S. Nicolay], [ Vehilius | n. sps. | Det. | S.S. Nicolay], [DNA sample ID: | NVG-19019B12 | c/o Nick

V. Grishin], [USNMENT | {QR Code} | 01532564], and one red [HOLOTYPE ♂ | Gubrus lubens | Grishin]. Type locality. Ecuador: Loja Province, km 28 of Loja –Catamayo road.

Etymology. In Latin, lugubris means sad, and lubens means happy, merry, joyful, willing, ready, or eager. This new species is happy to be the second species of this genus and is eager to be described here. The name is a masculine adjective.

Distribution. Currently known only from the holotype collected in Ecuador.