Dinapsis bicolor van Noort & Shaw, 2022

van Noort, Simon, Shaw, Scott Richard & Copeland, Robert S., 2022, Revision of the endemic African genus Dinapsis (Dinapsini, Megalyridae, Hymenoptera) with description of seven new species, ZooKeys 1112, pp. 27-122 : 27

Dinapsis bicolor van Noort & Shaw sp. nov.

Figs 4 , 5

Material examined.

Holotype. South Africa • ♀; Northern Cape, Tankwa National Park, Renoster River ; 490 m a.s.l.; 32°14.704'S, 20°05.824'E; 17 Aug.-9 Sep. 2014; S. van Noort leg.; Malaise trap; Acacia karoo thicket; Tanqua Wash Riviere; Succulent Karoo; TKW14-ACA1-M07; IMAGED WaspWeb LAS 4.9 SAMC 2019 (yellow label) ; HOLOTYPE Dinapsis bicolor van Noort & Shaw (red label); SAM-HYM-P088338; SAMC (DNA barcode sequence BOLD: FSA189521). Paratypes. South Africa • 1 ♀; Northern Cape, Avontuur Farm , 16 km NW Nieuwoudtville; 31°16.249'S, 19°02.900'E; 764 m a.s.l.; 27 Oct. 2009 - 9 Feb. 2010; S. van Noort leg.; Malaise trap; Bokkeveld Sandstone Fynbos; GL07-FYN1-M144; SAM-HYM-P040214; SAMC • 1 ♀; Northern Cape, Tankwa National Park, Renoster River ; 32°14.704'S, 20°05.824'E; 490 m a.sl.; 10 Jul.-17 Aug. 2014; S. van Noort leg.; Malaise trap; Acacia karoo thicket; Tanqua Wash Riviere; Succulent Karoo; TKW14-ACA1-M04; SAM-HYM-P048086; SAMC • 1 ♀; same data as holotype except for: SAM-HYM-P048086; SAMC • 3 ♀♀; same data as holotype except for: SAM-HYM-P047813; SAMC • 7 ♀♀; same data as holotype except for: 17 Aug.-9 Sep. 2014; TKW14-ACA1-M07; SAM-HYM-P047814; SAMC • 1 ♀; same data as holotype except for: 9 Sep.-9 Oct. 2014; TKW14-ACA1-M09; SAM-HYM-P047815; SAMC • 1 ♀; same data as holotype except for: 9 Oct.-5 Nov. 2014; TKW14-ACA1-M11; SAM-HYM-P047816; (SAMC) • 14 ♀♀; same data as holotype except for: 22 Jun.-24 Sep. 2015; TKW14-ACA1-M19; SAM-HYM-P088324 to SAM-HYM-P08837; SAMC .

Diagnosis.

This species is easily recognised by the distinctly bi-coloured body (Fig. 4A, B ): the metasoma is orange-brown contrasting with the black head and mesosoma, a unique colour pattern among the described species of Dinapsis (most species are overall black, but some undescribed Madagascan species have an orange head and mesosoma). The species falls within the D. oculohirta species group possessing the following diagnostic character states: eyes setose; face and mesosomal sculpture sparsely punctate; postocular orbital carina absent; antero-lateral corners of mesoscutum smoothly rounded without tubercles; scutoscutellar sulci comprising a line of adjacent large fovea, anteriorly meeting before reaching transscutal articulation; wing veins strong, wing banding light-brown, fainter than in other species with banding.

Distribution.

(Fig. 44 ) South Africa (Northern Cape Province).

Comments.

Dinapsis bicolor is probably also present in the Western Cape, as the Tankwa type locality is situated directly on the border between these two provinces. This is an arid-adapted species, collected from low rainfall regions in the Succulent Karoo and Bokkeveld Sandstone Fynbos, reflected in the orange colour of the metasoma a common colour present on the body of wasp species from arid regions.

Etymology.

This species is named for the contrasting colour between the metasoma and the rest of the body. Noun in apposition.

Barcode sequence for holotype specimen.

38754_A03_SAM-HYM-P088338 (sequence code in BOLD:FSA1895-21) BIN URI: BOLD:AEH7061.

Nucleotide sequence.

TTTATTGGGTCGTCTATAAGTATAATTATTCGGATAGAATTAAGGGTTCCTGGTTCATTTATTGGTAATGATCAAATTTATAATTCAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTTTTATAATAGGAGGTTTTGGTAATTGATTGTTACCATTAATATTAGGAGCTCCTGATATATCTTATCCACGTTTAAATAATTTAAGATTTTGATTATTAATTCCTTCTTTATTATTTTTATTAATAAGATTTTATGTAGGTGGTGGTACAGGTACAGGGTGAACTGTGTATCCCCCATTGTCTTCAAATATATTTCATTCTGGAATAAGGGTAGATCTATCAATTTTTAGATTACATTTAGCTGGAATTTCATCAATTTTAGGCTCAGTTAATTTTATTTCAACAATTTTAAATTTGCGTAATATTAAATTATCAGTAAGTAATTTAAGGTTATTTATTTGATCAGTGTTTTTAACAGCTATTTTATTATTATTATCTTTACCTGTATTAGCAGGGGCTATTACTATATTGTTAACGGATCGTAATTTAAATACAACATTTTTTGACCCTTCAGGGGGCGGTGATCCAATTTTATATCAACATTTATTT.

Description.

Holotype female. Body length 3.5 mm excluding ovipositor.

Colour. Head and mesosoma black with minute white setae, interspersed with darker longer setae; metasoma orange-brown, dorsally darker on last three tergites. Scape, pedicel, F1, F2, fore coxa, trochanters, tibiae, tarsi, ovipositor dark orange-brown; mandibles and hind leg reddish brown. Remaining antennal segments, fore and mid coxae and femora, wing venation, and ovipositor sheath dark brown. Eyes and ocelli silvery. Wing membrane clear except two dark brown pigmented bands across forewing with the apical band extending in a lighter infuscation almost to apical margin, and all the way to posterior margin in apical 1/2 of wing.

Head oval, 1.44 × wider than height; vertex, frons, and face evenly sparsely punctate, interstices polished and 1-3 × greater than puncture width; ocelli small, OOL 3.0 × ocellar diameter; ocellar triangle equilateral; eye large and slightly protuberant, nearly parallel in anterior view, but diverging slightly ventrally; eye densely and evenly covered with minute white ocular setae; eye margined posteriorly by foveate groove; postocular orbital carina absent; antenna with 11 flagellomeres having flagellar length/width ratios as follows: F1 = 3.5, F2 = 3.0, F3-F11 = 2.5, F12 (apical flagellomere) = 3.0; apical flagellomere same width as basal flagellomeres; temple adjacent to ocular orbital carina punctate and polished, becoming areolate-reticulate towards occipital carina, temple width 0.88 × eye width in lateral view; malar space length 1.0 × mandible width basally; occiput areolate-reticulate, occipital carina wide and crenulate.

Mesosoma. Pronotum polished, laterally excavated with a row of large oblong foveae situated dorsally and posteriorly; the mesoscutal anterior plate polished, with a medial row of punctures, and a lateral carina bounding a foveate groove; mesoscutum as long as wide, mesoscutal lobes sparsely punctate, polished, antero-lateral corners smoothly rounded without tubercles; medial mesoscutal furrow jagged with foveae; transscutal articulation a smooth furrow, anterior edge crenulated, posterior edge smooth; scutoscutellar sulci comprising a line of adjacent large foveae, anteriorly meeting before reaching transscutal articulation; scutellar disc medially polished, with scattered punctures laterally; scutellar disc medially devoid of setae, peripherally rimmed with erect setae; mesopleuron antero-laterally strongly foveate and sparsely setose, medially polished with sparse punctures and setae, and with large median mid-pit; propodeum medially with strongly developed transverse carinae between submedian longitudinal carinae, progressively less transverse carinae present from central to lateral longitudinal tracks.

Legs. Apex of fore tibia with comb of 13 or 14 stout spines; hind coxa sparsely punctate, weakly covered with long, silky, white setae not obscuring surface; hind femur stout, polished, 2.6 × longer than wide, outer surface of hind femur sparsely, but evenly covered with long, erect, white setae, inner surface of hind femur polished sparsely punctate with very short setae; surface of hind tibia polished, sparsely punctate with long erect white setae dorsally and ventrally, shorter adpressed setae laterally; dorsal setae lacking spatulate tips; inner median margin of hind tibia with a dense longitudinal patch of shorter white setae; hind basitarsus long, subequal in length to remaining four tarsomeres combined; basitarsus ventrally with sparse preening brush consisting of numerous short, white setae, inclined posteriorly; basitarsus dorsally with normal hair-like setae, lacking spatulate tips; T2, T3, and T4 each short, T2 twice as long as wide, T3 and T4 ca. as long as wide; all tarsomeres with normal hair-like setae; tarsal claw simple, strongly curved.

Wings. Forewing length 2.8 mm, 2.95 × longer than wide; wing basally with cells R and 1A largely devoid of setae; 1R1 and 1M with larger, more sparse setae compared to wing apical of these cells, which is evenly covered with smaller, more dense setae; wing clear, with two dark pigmented vertical bands. Basal wing band narrowest dorsally, starting at basal corner of cell 1M and anterior end of cell R, extending ventrally to cover entire cell 2CU and 3A; apical wing band wider, starting at base of pterostigma, and anterior end of 1R1, extending apically to almost cover entire marginal cell 2R1, ventrally to almost cover entire cell 1+2RS, ventrally wider and more diffuse, with infuscate pigmentation extending across cells 2+3M and 3CU, to lower wing margin and extending towards apical margin not quite reaching wing edge; forewing venation with vein Rs apically curving abruptly towards anterior wing margin to form short, truncate marginal cell 2R1; apical segment of vein M long, extending beyond apex of marginal cell, vein M with small white bulla situated almost 3/5 of vein length. Hind wing with apical stub of vein Rs 2/3 of shortest width between the propodeal submedian longitudinal carinae.

Metasoma in dorsal view 1.47 × longer than wide, with seven dorsally visible terga, all smooth and shining except for terga 6 and 7, which are finely shagreened; exposed portion of ovipositor, in lateral view, sub-equal in length to metasomal length; ovipositor sheaths setose, strongly curled (an artefact of preservation).

Variation present in paratype females.

Hind leg may be lighter reddish brown in colour than holotype. Body length 2.25-3.8 mm. Forewing length 1.9-2.8 mm.

Figures

Figure 4. Dinapsis bicolor van Noort & Shaw, sp. nov. holotype female SAM-HYM-P 088338 (SAMC) A habitus, dorsal view B habitus, lateral view C head, mesosoma, dorsal view D head, mesosoma, lateral view E head, anterior view F head, dorsal view. Scale bars: 1000 µm (A, B); 200 µm (C, E, F); 500 µm (D).

Figure 5. Dinapsis bicolor van Noort & Shaw, sp. nov. holotype female SAM-HYM-P 088338 (SAMC) A head, mesosoma, lateral view B mesoscutum, anterodorsal view C metasoma, dorsal view D metasoma, lateral view E hind leg, lateral view F wings, dorsal view (inset: data labels). Scale bars: 200 µm (A-C, D, E); 500 µm (F).

Figure 44. Distribution map of Dinapsis species occurring on the African mainland (specimen point data plotted on a topographical relief map).