Ancylogastra boireaui Bassi & Sáfián, 2021

Bassi, Graziano, Sáfián, Szabolcs, Léger, Théo, Müller, Günter C., Kravchenko, Vasiliy D. & Poltavsky, Alexander N., 2021, Ancylogastra, a new genus of Afrotropical Crambinae, with descriptions of seven new species (Lepidoptera, Pyraloidea, Crambidae), Zootaxa 5052 (1), pp. 42-60 : 51-52

publication ID

https://doi.org/10.11646/zootaxa.5052.1.2

publication LSID

lsid:zoobank.org:pub:45E35EB1-E06E-4EFD-969F-5E3A63956883

DOI

https://doi.org/10.5281/zenodo.5567298

persistent identifier

https://treatment.plazi.org/id/03EF87C1-505B-FFE7-FF22-FD5DE197FC6C

treatment provided by

Plazi

scientific name

Ancylogastra boireaui Bassi & Sáfián
status

sp. nov.

Ancylogastra boireaui Bassi & Sáfián , sp. n.

( Figs 3 View FIGURES 1–8 , 14, 15 View FIGURES 9–15 , 34, 36 View FIGURES 34–37 )

Holotype male with labels: 1) Holotypus; 2) Guinea, Nimba Mountains , Richard Molard Camp, 1382 m, 1-8.vi.2019, at light, 07°36’N, 08°25’W, S. Sáfián legit, 3) Ancylogastra boireaui Bassi & Sáfián GoogleMaps , Holotype, G. Bassi det. Deposited in RCGB .

Paratypes: 4 males, 3 females, same data as holotype, GS 6630, 6655, 6860, 6870 and 6882 GB; MFNLEP099, MFNLEP100 and MFNLEP101, RCGB, MHNG .

Diagnosis. Ancylogastra boireaui sp. n. ( Fig. 3 View FIGURES 1–8 ) is characterized by the black brown forewing, suffused with yellow. Externally the species resembles A. gangraensis sp. n. ( Fig. 4 View FIGURES 1–8 ) described below, but A. boireaui sp. n. is more intense in ground colour and clearly larger wingspan (25–31 mm vs. 15–23 mm). In male genitalia ( Fig. 14 View FIGURES 9–15 ) the slender costal arm medially bent inward and the large cornutus distinguish A. boireaui sp. n. from its congeners. The female genitalia ( Fig. 34 View FIGURES 34–37 ) of A. boireaui sp. n. are characterized by the strongly produced and pointed sterigma and the stout extension of the ductus bursae, unlike those of all congeners. COI barcode sequence of MFNLEP100, BOLD ID = AFROC005-20 (646 bp):

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGTCTATTAATTCGAGCTGAATTAGGAAATCCAGGTTCATTAATTGGTGATGATCAAATTTATAATACTATCGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCAATCATAATTGGTGGATTTGGTAATTGATTAG TTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAACATAAGATTTTGACTACTTCCTCCTTCATTAACCCTTTTAATTTCTAGAAGAATTGTTGAAAACGGAGCAGGAACAGGATGAACAGTATATCCCCCCCTTTCGTCTAATATTGCTCACGGTGGAGGATCAGTTGATTTAGCTATTTTTTCC TTACATTTAGCTGGTATTTCCTCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATGGATTATCTTTTGATCAAATACCTTTATTTGTTTGATCAGTAGGTATTACAGCTTTATTACTCCTTCTTTCTCTTCCTGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCTTTCTTTGATCCAGCTGGAGGAGGAGATCCTATTCTCTAT

Etymology. Named after Patrick Boireau, French lepidopterist, who has been working in the Nimba and Ivory Coast for decades.

Description ( Fig. 3 View FIGURES 1–8 ). Wingspan: males 25–27 mm, females 30–31mm. Labial palpi four and a half times as long as eye diameter, charcoal grey with dorsal side off-white. Maxillary palpi subtriangular, charcoal tipped offwhite. Antenna strongly bipectinate in male, with rami four times as long as flagellomere, black with costa charcoal lightening apically; in female simple, brown with costa grey. Frons rounded, moderately produced, yellow with dark dot medially. Ocelli and chaetosemata normally developed. Vertex off-white with raised scales. Patagia pale yellow. Tegulae pale yellow with inner side black. Thorax off-white to pale yellow. Forewing subrectangular, with rounded apex and slightly oblique termen; ground colour black brown suffused with yellow, pale brown and off-white; costal line black; costal stripe white bordered yellow; medial stripe originates from one-third of length of wing, white bordered blackish brown, reaching subterminal area; subdorsal stripe large, white; dorsum yellowish white sprinkled with black; subterminal area white with seven rectangular black spots and subterminal fascia arched, silvery white bordered yellow; fringes silvery white with both short and long scales tipped grey; underside charcoal with costa partially yellow; fringes with both short and long scales yellow tipped grey. Hindwing white with yellow suffusion; fringes white with pale yellow basal suffusion; underside white, strongly suffused with brown dorsally; fringes with short scales off-white tipped grey and long scales white tipped grey. Foreleg bronze brown; mid and hindleg bronze brown with inner side white. Abdomen off-white. Tergite of male abdominal segment VIII as in Fig. 15 View FIGURES 9–15 .

Male genitalia ( Fig. 14 View FIGURES 9–15 ). Uncus slightly longer than gnathos, slightly curved distally. Gnathos almost straight, with rounded apex. Tegumen long and narrow. Vinculum stout, caudally bifid. Pseudosaccus subconical, small. Juxta large, broadly v-shaped. Valva elongated, narrowing toward apex; costal arm slightly longer than valva, narrow, distally strongly upcurved and with acuminate apex. Phallus broad, slightly shorter than valva, with blunt apex; vesica with one large and arched cornutus.

Female genitalia ( Figs 34, 36 View FIGURES 34–37 ). Papillae anales rounded in dorso-lateral view. Apophyses posteriores basally subtriangular, then slightly arched and medially bulged. Abdominal segment VIII wavy, moderately sclerotised. Apophyses anteriores basally enlarged, then narrow, slightly curved. Sterigma jagged dorsally, triangular and strongly produced ventrally. Ostium bursae membranous, bordered by a sclerotised ring. Ductus bursae narrower than ostium bursae, longer than corpus bursae, with moderate sclerotisation along its length, ending at inception of ductus seminalis; lateral extension short, large, jagged, strongly sclerotised medially. Corpus bursae membranous, delicately wrinkled.

Distribution. Only known from the type locality in Guinea.

Remarks. The adults were attracted to an artificial light in a mixed vegetation habitat around Richard Molard Camp, 1382 meters a.s.l., Nimba Mountains ( Fig. B View FIGURE B ).

MHNG

Museum d'Histoire Naturelle

Kingdom

Animalia

Phylum

Arthropoda

Class

Insecta

Order

Lepidoptera

SuperFamily

Pyraloidea

Family

Crambidae

SubFamily

Crambinae

Genus

Ancylogastra

GBIF Dataset (for parent article) Darwin Core Archive (for parent article) View in SIBiLS Plain XML RDF