Anacharis minima Vogel, Forshage & Peters, 2024

Vogel, Jonathan, Forshage, Mattias, Bartsch, Saskia B., Ankermann, Anne, Mayer, Christoph, von Falkenhausen, Pia, Rduch, Vera, Müller, Björn, Braun, Christoph, Krammer, Hans-Joachim & Peters, Ralph S., 2024, Integrative characterisation of the Northwestern European species of Anacharis Dalman, 1823 (Hymenoptera, Cynipoidea, Figitidae) with the description of three new species, Journal of Hymenoptera Research 97, pp. 621-698 : 621-698

publication ID	https://doi.org/ 10.3897/jhr.97.131350
publication LSID	lsid:zoobank.org:pub:EA190992-B01B-4F1B-A362-A4549C725580
DOI	https://doi.org/10.5281/zenodo.13517416
persistent identifier	https://treatment.plazi.org/id/22711BED-98BF-4795-A81E-B709E12667E1
taxon LSID	lsid:zoobank.org:act:22711BED-98BF-4795-A81E-B709E12667E1
treatment provided by	Journal of Hymenoptera Research by Pensoft
scientific name	Anacharis minima Vogel, Forshage & Peters
status	sp. nov.

Treatment

Anacharis minima Vogel, Forshage & Peters sp. nov.

Fig. 14 A – E View Figure 14

Diagnosis

(n = 1). Belongs to the eucharioides species group. Small species (2.4 mm). Similar to A. petiolata and A. typica by having a centrally smooth mesoscutellum (centrally carinate in A. eucharioides , A. martinae and A. maxima ). The small body size and the narrow coriaceous texture of the malar space that extends only around the dorsal corner of the mandibular base (Fig. 19 A View Figure 19 ) is unique in the Palaearctic fauna (coriaceous texture of malar space extending along entire length of mandibular base in all other species).

Description.

Female. Size. Small; body: ♀ 2.4 mm. Antennae: ♀ 1.6 mm. Fore wing: 1.9 mm

Colour. Body black (Fig. 14 A View Figure 14 ); scape, head, mesosoma, coxa, petiole black (Fig. 14 View Figure 14 ); mandibles (Fig. 14 C View Figure 14 ), palps (Fig. 14 B View Figure 14 ), rest of legs (hind tarsi darker) (Fig. 14 A View Figure 14 ) yellow; pedicel and flagellomeres (Fig. 14 A View Figure 14 ), tegulae (Fig. 14 B, D View Figure 14 ), and gaster (Fig. 14 A View Figure 14 ) dark brown.

Head. Roundish triangular in frontal view, genae not abruptly kinked (Fig. 14 C View Figure 14 ); lower face setose (Fig. 14 C View Figure 14 ), with punctures; clypeal margin margin bilobed and flanged, clypeus smooth; coriaceous texture of malar area narrow, coriaceous texture of the malar space narrow, extending only around the dorsal corner of the mandibular base (Fig. 19 A View Figure 19 ); genae smooth around eye, with increasingly dense punctation and regular setae towards the hind margin (Fig. 14 A View Figure 14 ); upper face sparsely setose and very few punctures, centrally with shallow dent (Fig. 14 C View Figure 14 ); space between toruli smooth; eyes with scattered setal stubs (Fig. 14 C View Figure 14 ); ocellar triangle with wide base, ocelli small, POL: OOL: LOL: OD = 3.1: 1.7: 1.4: 1.0; setose between lateral ocellus and eye, small glabrous area in front of median ocellus not reaching median dent of upper face; head in dorsal view 1.8 times wider than long, laterally longer than medially; vertex and occiput with smooth shallow median furrow, occiput with medially interrupted striolation (Fig. 14 D View Figure 14 ).

Antennae. ♀ formula:

1.9: 1.0: 2.1: 1.4: 1.4: 1.4: 1.4: 1.3: 1.2: 1.2: 1.2: 1.1: 2.1

Mesosoma. Mesosoma 1.3 times longer than high (Fig. 14 B View Figure 14 ); pronotal plate coriaceous, with some few radial carinae; pronotum laterally setose (Fig. 14 B View Figure 14 ), with only few carinae ventrally and along anterior margin (Fig. 14 B View Figure 14 ), posterodorsal area smooth and even (Fig. 14 B View Figure 14 ); mesopleuron without distinct coriaceous sculpture, scrobiculate along anterior margin (Fig. 14 B View Figure 14 ), setose along ventral margin, otherwise glabrous (Fig. 14 B View Figure 14 ); mesopleural line meeting posteroventral hypocoxal furrow with its ventral margin only, ventral margin somewhat continuous, dorsally marked by influent striae (Fig. 14 B View Figure 14 ); mesopleural triangle separated from mesopleuron by carina that fades before reaching the posterior subalar pit, setae mostly in anterior two-thirds; axillulae well delimited, inside setose and longitudinally rugose-carinate; mesoscutum 1.1 times wider than long and 1.4 times longer than the mesoscutellum (Fig. 14 D View Figure 14 ); notauli complete, inside not carinate, wrinkles weak to absent (Fig. 14 D View Figure 14 ); lateral and median lobes of mesoscutum centrally glabrous, otherwise setose, increasingly so towards margins (Fig. 14 D View Figure 14 ); mesoscutellar foveae closed, with circumfoveal carina delimiting each fovea (Fig. 14 D View Figure 14 ), not touching the median carina (Fig. 14 D View Figure 14 ); mesoscutellum smooth on dorsal and posterior surface (Fig. 14 D View Figure 14 ), posterior surface medially distinctly raised (Fig. 14 D View Figure 14 ), laterally smooth (Fig. 14 D View Figure 14 ); ventral half of dorsal axillular area rugose (Fig. 14 E View Figure 14 ); propodeal area defined by carinae (Fig. 14 E View Figure 14 ), inside carinate-rugose, median carina present ventrally (Fig. 14 E View Figure 14 ); nuchal collar broadly extending posteriorly, tip rounded (Figs 6 D View Figure 6 , 14 E View Figure 14 ).

Wings. Marginal cell of fore wing 2.6 times longer than wide.

Metasoma. 1.2 times longer than rest of body (Fig. 14 A View Figure 14 ); gaster 2.3 times longer than petiole (Fig. 14 A View Figure 14 ); petiole 1.5 times longer than hind coxa Fig. 14 A View Figure 14 ); metasomal tergite 2 (T 2) and T 3 with weak line of punctures dorsally, T 4 with scattered band of punctures, T 5-6 with narrow band, T 7 with medially weaker band, laterally with few setae.

Male. Unknown

CO 1 barcode.

n = 1. Maximum intraspecific distance = not applicable. Minimum distance to closest species ( A. eucharioides ) = 5.6 %. CO 1 barcode consensus sequence:

AATTTTATACTTTATTTTAGGTATTTGATCCGGAATAATAGGTTCAAGATTAAGAATAATTATTCGAAT AGAACTAGGAACCCCATCTCAATTAATCATAAATGATCAAATTTATAATTCAATTGTAACCGCACATGCC TTTATTATAATTTTTTTTATAGTTATACCCATTATAGTAGGAGGATTTGGAAATTATTTAGTGCCTTTAA TATTAATCTCTCCTGATATAGCTTTCCCACGATTAAATAATTTAAGATTTTGATTTTTAATCCCTTCCCT ATTTTTAATAACAATTAACTTATTTATTGATCAAGGAGCAGGGACAGGATGAACTGTATACCCACCATTA TCATCCCTCACAGGTCATCCATCTATATCAGTAGATTTAGTTATTTATTCACTACATTTAAGAGGTATCT CATCAATTCTTGGATCAATTAATTTTATTGTAACCATTTTAAATATACGAATAAACTCTGTATCTATAGA CAAAATTTCATTATTTATTTGATCTATCTTTTTAACTACAATTTTACTATTATTATCTTTACCTGTATTA GCAGGAGGATTAACTATATTATTATTTGATCGAAATTTAAATACATCTTTTTTTGACCCTACAGGAGGGG GAGACCCAATTCTTTATCAACACTTATTT

Type material.

Holotype. Germany • ♀; Baden-Württemberg, Karlsruhe, Malsch, Hansjakobstraße , garden; 48.8835 ° N, 8.3197 ° E; ca 120 m a. s. l.; 25 Oct. - 8 Nov. 2020; Dieter Doczkal leg.; Malaise trap; ZFMK -TIS-2640724 . GoogleMaps

Biology.

The holotype was collected in autumn (between October and November) in a garden.

Distribution.

Germany (locus typicus : Karlsruhe, Malsch).

No DNA barcode matches with publicly available sequences from other countries.

Holotype collected from ca. 120 m a. s. l.

Etymology.

From the latin word for “ the smallest ”, referring to its distinct small body size.

Remarks.

While A. minima is molecularly clearly distinct from other species, the morphology overlaps in many aspects with other species that show a smooth mesoscutellum. It is the name-giving small size that seems to hold the most diagnostic value but there is no way to say for sure which characters are morphologically diagnostic for A. minima based on a single specimen. Some specimens, which we currently classify as A. typica ( NHRS - HEVA 000023181 and a specimen from MHNG) show similarities to the holotype of A. minima , but they deviate in size and sculpture to regard them as not conspecific. The morphological diagnosis is in need of extension by studying further material of which the barcode matches that of A. minima .