Anacharis petiolata ( Zetterstedt, 1838 )

Vogel, Jonathan, Forshage, Mattias, Bartsch, Saskia B., Ankermann, Anne, Mayer, Christoph, von Falkenhausen, Pia, Rduch, Vera, Müller, Björn, Braun, Christoph, Krammer, Hans-Joachim & Peters, Ralph S., 2024, Integrative characterisation of the Northwestern European species of Anacharis Dalman, 1823 (Hymenoptera, Cynipoidea, Figitidae) with the description of three new species, Journal of Hymenoptera Research 97, pp. 621-698 : 621-698

Anacharis petiolata ( Zetterstedt, 1838) stat. rev.

Figs 2 C , 15 A – E

Cynips petiolata Zetterstedt, 1838: 409 - lectotype ( MZLU) ♀, photographs examined.

Anacharis gracilipes Ionescu, 1969: 75 syn. nov. (removed from synonymy with A. eucharioides) - holotype ( MGAB) ♀, examined.

Diagnosis

(n = 9). Belongs to the eucharioides species group. Medium sized species (3.0–3.4, mean 3.2 mm, similar to A. eucharioides , A. martinae and A. typica ). Differing from A. eucharioides and A. martinae by having a centrally smooth mesoscutellum (Fig. 15 D, E , centrally carinate in A. eucharioides and A. martinae ) and a smooth lateromedial area of the pronotum (Fig. 15 B , rugose to obliquely carinate in A. eucharioides and A. martinae ). Differs from A. typica mainly by having the hind coxa less distinctly bicoloured, weak paling is notable apically (Fig. 15 A , distinctly bicoloured with distinct paling in hind coxa in A. typica ). The hind trochanter in A. petiolata is similarly dark as the hind coxa (similar pattern of paling as hind coxa or pale as hind femur in A. typica ). Additional to morphological differences, based on the limited material at hand, A. petiolata seems to be exclusively collected in boreal or montane environments from above 1,000 meters above sea level (whilst A. typica is collected from temperate environments below 700 meters above sea level).

CO 1 barcode.

n = 9. Maximum intraspecific distance: 2.2 %. Minimum distance to closest species ( A. eucharioides ): 3.2 %. CO 1 barcode consensus sequence:

AATTTTATACTTTATTTTAGGTATTTGATCAGGAATAATAGGATCAAGATTAAGAATAATTATTCGAAT AGAGTTAGGTACCCCATCTCAATTAATTATAAATGATCAAATTTATAATTCAATTGTAACTGCACATGCA TTTATCATAATTTTCTTTATAGTTATACCTATCATAGTAGGAGGATTTGGAAATTATTTAGTACCTTTAA TATTAATCTCTCCTGATATAGCTTTCCCACGATTAAATAATTTAAGATTTTGATTTGCAATCCCTTCCTT ATTTTTAATAACAATTAATTTATTTATCGACCAAGGAGCAGGAACAGGATGAACTGTTTATCCTCCATTA TCCTCTCTAACAGGTCACCCATCTATATCAGTAGATTTAGTTATTTATTCATTACATTTAAGTGGAATCT CTTCAATTCTTGGATCAATTAATTTTATTGTTACCATTTTAAATATACGAATAAATTCTATATTTATAGA CAAAATTTCATTATTTATTTGATCTATTTTTCTAACTACAATTTTACTATTATTATCTTTACCCGTACTA GCAGGAGGATTAACTATACTATTATTTGATCGAAATTTAAATACATCTTTTTTTGACCCCACAGGAGGGG GAGACCCAATCCTTTATCAACATTTATTT

Type material.

Lectotype of Cynips petiolata Zetterstedt, 1838

LECTO-TYPE

C. petiola ta ♀.

1982 855

LECTOTYPE Cynips petiolata Zett det. N. D. M. Fergusson, 1982

Anacharis eucharoides (Dal.) det. N. D. M. Fergusson, 1982

MZLU 00207341

MZLU Type no. 7814: 1

[for images, see https://www.flickr.com/photos/tags/mzlutype07814]

Holotype of Anacharis gracilipes Ionescu 1969

Anacharis gracilipes n. sp. ♀ Holotip

26.7. 956 Rarău,

GAL 0340 / 9

Anacharis eucharoides ♀ ( Dalman, 1823) JP-V 2012 det

HOLOTYPUS, Anacharis gracilipes Ionescu, 1969 , MGAB

[Fig. 16 E ]

Other material examined.

DNA barcode vouchers. Germany • 1 ♀; Bavaria, Allgäu, Oberstdorf, Oytal , Schochen , alpine meadow; 47.392 ° N, 10.37 ° E; ca 1930 m a. s. l.; 6 Aug. 2014; BC- ZSM -HYM-24109-D 01 ( ZSM) . • 1 ♀; same collection data as for preceding; 4 Sep. 2014; BC- ZSM -HYM-24073-F 03 ( ZSM) . • 1 ♀; Bavaria, Allgäu, Oberstdorf, Schochen , south faced ridge; 47.394 ° N, 10.369 ° E; ca 2030 m a. s. l.; 6 Aug. 2014; BC- ZSM -HYM-24066-H 09 ( ZSM) . • 1 ♀, 1 ♂; Bavaria, Garmisch-Partenkirchen, Zugspitze , mountain; 47.4062 ° N, 11.0095 ° E; ca 1970 m a. s. l.; 20 Jun. - 5 Jul. 2018; Doczkal, D., Voith, J. leg.; Malaise trap; female - ZFMK -TIS-2637891 ; male - ZFMK -TIS-2637890 . • 2 ♀♀, 1 ♂; Bavaria, Garmisch-Partenkirchen, Zugspitze , mountain; 47.4068 ° N, 11.008 ° E; ca 2010 m a. s. l.; 20 Jun. - 5 Jul. 2018; Doczkal, D., Voith, J. leg.; Malaise trap; females - ZFMK -TIS-2628236 , ZFMK -TIS-2629285 ; male - ZFMK -TIS-2628237 . • 1 ♀; same collection data as for preceding; 2–13 Aug. 2018; ZFMK -TIS-2637893 .

Greenland • 1 ♀, 2 ♂♂; SouthWest Greenland, Evighedsfjord, Kangiussaq ; 65.8667 ° N, - 52.2 ° E; ca 30 m a. s. l.; 19 Jul. - 20 july 2003; Kissavik Exp., ZMUC leg.; female - zmuc 00023359 ( ZMUC); males - zmuc 00023357 ( ZMUC), zmuc 00023358 ( ZMUC) .

Material without DNA barcode. Germany • 1 ♂; Bavaria, Garmisch-Partenkirchen, Zugspitze , mountain; 47.4053 ° N, 11.0091 ° E; ca 1980 m a. s. l.; 18 Jul. - 2 Aug. 2018; Dieter Doczkal | Johannes Voith leg.; Malaise trap; ZFMK -HYM-00039678 . • 4 ♀♀; Bavaria, Garmisch-Partenkirchen, Zugspitze , mountain; 47.4062 ° N, 11.0095 ° E; ca 1970 m a. s. l.; 20 Jun. - 5 Jul. 2018; Dieter Doczkal | Johannes Voith leg.; Malaise trap; ZFMK -HYM-00039679 , ZFMK -HYM-00039680 , ZFMK -HYM-00039681 , ZFMK -HYM-00039682 . • 1 ♂; same collection data as for preceding 5–18 Jul. 2018; ZFMK -TIS-2642567 . • 2 ♀♀; same collection data as for preceding 18 Jul. - 2 Aug. 2018; ZFMK -TIS-2642535 , ZFMK -TIS-2642547 . • 1 ♂; Bavaria, Garmisch-Partenkirchen, Zugspitze , mountain; 47.4068 ° N, 11.008 ° E; ca 2010 m a. s. l.; 5–18 Jul. 2018; Dieter Doczkal | Johannes Voith leg.; Malaise trap; ZFMK -TIS-2642544 . • 2 ♂♂; Bavaria, Garmisch-Partenkirchen, Zugspitze, Platt , mountain; 47.4053 ° N, 11.0091 ° E; ca 1980 m a. s. l.; 5–18 Jul. 2018; Dieter Doczkal | Johannes Voith leg.; Malaise trap; ZFMK -TIS-2640706 , ZFMK -TIS-2640707 . • 1 ♂; same collection data as for preceding 18 Jul. - 2 Aug. 2018; ZFMK -HYM-00039678 .

Greenland • 1 ♀; Narssarssuaq ; 61.1 ° N, - 45.25 ° E; ca 0 m a. s. l.; 5 Jul. 1983; Peter Nielsen leg.; NHMD 918327 ( ZMUC) . • 2 ♂♂; same collection data as for preceding 1 Aug. 1983; NHMD 918299 ( ZMUC), NHMD 918313 ( ZMUC) . • 1 ♀; same collection data as for preceding 13 Aug. 1983; NHMD 918341 ( ZMUC) . • 1 ♀ 3 ♂♂; SouthWest Greenland, Evighedsfjord, Kangiussaq ; 65.8667 ° N, - 52.2 ° E; ca 30 m a. s. l.; 19–20 Jul. 2003; Kissavik Exp., ZMUC leg.; female - zmuc 00023359 ( ZMUC); males - NHMD 918215 ( ZMUC), zmuc 00023357 ( ZMUC), zmuc 00023358 ( ZMUC) . • 1 ♂; same collection data as for preceding 24–25 Jul. 2003; NHMD 918229 ( ZMUC) . • 1 ♀; SouthWest Greenland, Itivleq , eastern end; 66.55 ° N, - 52.4333 ° E; ca 0 m a. s. l.; 22–23 Jul. 2003; Kissavik Exp., ZMUC leg.; NHMD 918285 ( ZMUC) . • 1 ♀; SouthWest Greenland, Kangerdluarssuk east; 66.9833 ° N, - 53.2 ° E; ca 20 m a. s. l.; 24–25 Jul. 2003; Kissavik Exp., ZMUC leg.; NHMD 918271 ( ZMUC) . • 1 ♀, 1 ♂; West Greenland, Qarássap munatâ ; 70.75 ° N, - 53.62 ° E; ca 710 m a. s. l.; 18–19 Jul. 1969; Jens Böcher leg.; female - NHMD 918243 ( ZMUC); male - NHMD 918257 ( ZMUC) .

Switzerland • 1 ♀; Neuchâtel, Auvernier ; 16 Aug. 1956; Jacques de Beaumont leg.; specimen at MHNG . • 2 ♂♂; same collection data as for preceding 26 Aug. 1956; specimens at MHNG . • 1 ♂; Vaud, Ferreyres ; 22 Aug. 1952; Jacques de Beaumont leg.; specimen at MHNG . • 1 ♂; Vaud, La Sauge ; 10 Aug. 1959; Jacques de Beaumont leg.; specimen at MHNG . • 2 ♂♂; same collection data as for preceding 29 Aug. 1956; specimens at MHNG . • 1 ♀; Vaud, Lioson Sep. 1956; Jacques de Beaumont leg.; specimen at MHNG . • 1 ♀; Vaud, Marchairuz ; 21 Jul. 1960; Jacques de Beaumont leg.; specimen at MHNG . • 1 ♀; Vaud, Sta Catharina ; 17 Sep. 1955; Jacques de Beaumont leg.; specimen at MHNG .

Biology.

Summer species, flying from July to September, peak in July. Seems confined to alpine, arctic or boreal habitats.

Distribution.

Finland (locus typicus of A. petiolata : Lapland, Muonio, likely on Finnish side of Muonio River, see remarks), Germany (Alps), Greenland, Romania (locus typicus of A. gracilipes : Rarău massif (Eastern Romanian Carpathians) at “ 1,950 m ” altitude according to Ionescu (1969) [highest peak according to Wikipedia is at 1651 m]), Switzerland.

DNA barcode matches with publicly available sequences from Canada (e. g. ABINP 3207-21) and Norway (e. g. GWNWG 2160-14).

In Central Europe restricted to elevations above 1900 m a. s. l. but occurring at lower altitudes in arctic and subarctic, boreal landscapes.

Remarks.

A. petiolata ( Zetterstedt, 1838, often erroneously cited as Zetterstedt, 1840) was synonymised with A. eucharioides by Fergusson (1986) and was erroneously listed as synonym of A. immunis in Mata-Casanova et al. (2018). The type locality of A. petiolata is Muonio, Lapland (in the description: “ Pinetis Lapponiae ad Muonioniska ” ( Zetterstedt 1838)). Muonio is a municipality in present-day Finland (belonging to Russia at the time of Zetterstedt’s visit), where Zetterstedt visited local entomologist Kolström during his 1821 Lapland journey. The Muoniojoki river, which flows indirectly downstream into the Torne river, marks the border between Finland and Sweden near the municipality of Muonio and it is unclear whether Zetterstedt crossed it to collect insects from both sides of the river, though he mentions how scary it is to cross the river, making it unlikely that he frequently did so ( Zetterstedt 1822). In conclusion, whether the lectotype was collected in modern day Finland or Sweden is probably impossible to tell and the question itself of minor significance.

There are no descriptive labels on the lectotype. Fergusson (1986) stated that the lectotype was held at NHRS, but it is actually deposited at the MZLU. The sex of the lectotype is difficult to discern, due to the missing antennae and only images available to us. We consider it a male, as the original label shows, though that is in contrast to what Fergusson (1986) wrote. Apparently, the specimen was already in a poor condition when Fergusson studied it and he could not reliably identify the sex either.

On the primary type of A. gracilipes : Mata-Casanova et al. (2018) cites a lectotype of A. gracilipes as primary type. However, Ionescu specifically mentions a holotype in his publication, though without giving unambiguous details about the actual specimen ( Ionescu 1969). The ICZN states in 73.1. 2., that “ If the taxon was established before 2000 evidence derived from outside the work itself may be taken into account [Art. 72.4.1.1] to help identify the specimen. ” The loaned specimen from MGAB with the Museum ID “ GAL 340 / 9 ” bears the word “ holotip ” on its label, along with information on locality and time that match the description of the type series. The specimen thereby constitutes the holotype.

The holotype was kept in a vial with ethanol, already damaged, lacking head and wings, legs incomplete. We mounted the specimen on a white pointed card with Shellac Gel glue on the right side of its mesosoma after asking permission from MGAB. All coxae are present, fore trochanters and femora present, trochanter and femora of right hind leg mounted separately along with a tibia. The specimen was about 2.8 mm in body length (measurements on holotype combined with proportions from photograph in Ionescu, 1969) and that falls into the average body size of most Anacharis species. A. petiolata is morphologically very similar to A. typica. The morphological differences are rather subtle differences in colouration and morphological diagnoses for both species are rather weak. Still, we differentiate between the two species based on the distinct difference in CO 1 barcode sequences as well as a difference in habitat type / distribution. All known specimens of A. petiolata were collected in alpine or boreal environments, specimens of A. typica were collected in temperate environments below 700 meters above sea level.

Figures

Figure 2. Fore and hind wings of different species of Anacharis showing the WIPs A A. ensifer stat. rev. male (ZFMK - TIS- 2629206) B A. immunis male (ZFMK - TIS- 2629539) C A. martinae sp. nov. female holotype (ZFMK - TIS- 2640787) D A. typica stat. rev. female (ZFMK - TIS- 2640857) E A. maxima sp. nov. male paratype (ZFMK - TIS- 2640676) F A. petiolata stat. rev. female (ZFMK - TIS- 2629285) G A. eucharioides male (ZFMK - TIS- 2629201).

Figure 15. Anacharis petiolata, female (ZFMK - TIS- 2629285) A habitus B mesosoma lateral C face D mesosoma dorsal E mesosoma posterior view.

Figure 16. Lectotype of A. typica (A-C) and holotype of A. gracilipes (D, E) A labels, frontal B lectotype ventral C lectotype dorsal D holotype dorsal E holotype labels frontal, above and the back, below.