Cyclocosmia ruyi Yu & F. Zhang, 2023

Yu, Kun, Li, Changze, Zhang, Shuyuan & Zhang, Feng, 2023, A new trapdoor spider of Cyclocosmia Ausserer, 1871 from southern China (Araneae, Halonoproctidae), Biodiversity Data Journal 11, pp. 98311-98311 : 98311

Cyclocosmia ruyi Yu & F. Zhang sp. n.

Materials

Type status: Holotype. Occurrence: recordedBy: K. Yu & Y. Ding; sex: female; occurrenceID: B26D100E-7810-5506-81EC-3FF0AD 9AD 810; Taxon: scientificName: Cyclocosmia ruyi Yu & Zhang, sp. n.; Location : country: China; stateProvince: Guangxi; county: Jinxiu ; locality: Changdong Village , near Gubaotun ; verbatimElevation: 980 m; verbatimCoordinates: 110.1668°E, 24.0970°N; Identification: identifiedBy: K. Yu; Event: eventID: HBUARA#2022-138; eventDate: 3 Aug 2022; Record Level: institutionCode: MHBU-ARA-00023656 Type status: Paratype. Occurrence: recordedBy: K. Yu & Y. Ding; sex: 1 female; occurrenceID: 39128A4E-FE8F-592C-B347-587E66971A64; Taxon: scientificName: Cyclocosmia ruyi Yu & Zhang, sp. n.; Location : country: China; stateProvince: Guangxi; county: Jinxiu ; locality: Changdong Village , near Gubaotun ; verbatimElevation: 980 m; verbatimCoordinates: 110.1668°E, 24.0970°N; Identification: identifiedBy: K. Yu; Event: eventID: HBUARA#2022-138; eventDate: 3 Aug 2022; Record Level: institutionCode: MHBU-ARA-00023657 Type status: Paratype. Occurrence: recordedBy: W. Feng; sex: 1 male, 1 female; occurrenceID: 610035A4-763C-5D07-96BD-476A82FC3241; Taxon: scientificName: Cyclocosmia ruyi Yu & Zhang, sp. n.; Location : country: China; stateProvince: Guangxi; county: Jinxiu ; locality: Changdong Village , near Gubaotun ; verbatimElevation: 980 m; verbatimCoordinates: 110.1668°E, 24.0970°N; Identification: identifiedBy: K. Yu; Event: eventDate: 7 Oct 2022; Record Level: institutionCode: MHBU-ARA-00023658~00023659 Type status: Paratype. Occurrence: recordedBy: W. Feng; sex: 1 male (raised by C. Li and matured on 1 Oct 2022); occurrenceID: 06EAD122-F12C-5D31-91A6-9B73D04E142A; Taxon: scientificName: Cyclocosmia ruyi Yu & Zhang, sp. n.; Location : country: China; stateProvince: Guangxi; county: Jinxiu ; locality: Changdong Village , near Gubaotun ; verbatimElevation: 980 m; verbatimCoordinates: 110.1668°E, 24.0970°N; Identification: identifiedBy: K. Yu; Event: eventDate: 29 June 2022; Record Level: institutionCode: MHBU-ARA-00023660 Type status: Other material. Occurrence: recordedBy: W. Feng; sex: 1 male (penultimate); occurrenceID: D52EA05E-D9A1-5B54-A681-5608F39BA65E; Taxon: scientificName: Cyclocosmia ruyi Yu & Zhang, sp. n.; Location : country: China; stateProvince: Guangxi; county: Jinxiu ; locality: Changdong Village , near Gubaotun ; verbatimElevation: 980 m; verbatimCoordinates: 110.1668°E, 24.0970°N; Identification : identifiedBy: Kun Yu ; Event : eventDate: July 2017; Record Level: institutionCode: CKYH (DNA voucher number: KYU081) Type status: Other material. Occurrence: recordedBy: W. Feng; sex: 2 females (1 adult & 1 subadult); occurrenceID: ED50D521-B57C-5E45-9B27-22057CFBEE25; Taxon: scientificName: Cyclocosmia ruyi Yu & Zhang, sp. n.; Location : country: China; stateProvince: Guangxi; county: Jinxiu ; locality: Changdong Village , near Gubaotun ; verbatimElevation: 980 m; verbatimCoordinates: 110.1668°E, 24.0970°N; Identification : identifiedBy: Kun Yu ; Event : eventDate: July 2017; Record Level: institutionCode: CKYH (the subadult female were used for DNA extraction, DNA voucher number: KYU082)

Description

Female (Holotype, MHBU-ARA-00023656). Sclerotised parts of body mostly reddish-brown, membranes cream, cephalon and fovea slightly darker, opisthosoma yellowish-brown, but gradually darkens posteriorly, opisthosomal disc dark brown (Fig. 5 C). Colour slightly darker in life, especially cephalon and chelicerae (Fig. 2 C-F). Total length (not including chelicerae) 18.48. Carapace smooth, 7.93 long, 7.37 wide. Eyes on low mound, eye group 0.79 long, 2.10 wide anteriorly, 2.09 wide posteriorly. Eye diameters and interdistance: AME 0.24, ALE 0.43, PME 0.20, PLE 0.30, ALE-AME 0.36, AME-ALE 0.41, PME-PME 0.18, PME-PLE 0.21, ALE-PLE 0.15, MOA 0.84 long, front width 0.85, back width 1.47. Chelicerae robust, promargin of cheliceral groove with 12 and retromargin with 10 denticles of different sizes, arranged in irregular rows. Rastellum carrying one retrolateral-proximal spine and ca. 10 distal spines. Maxillae 3.28 long, 2.06 wide, carrying 12/9 cuspules in prolateral-proximal corner and many weaker spicules all over ventral surface. Labium 1.43 long, 2.00 wide, carrying two cuspules. Sternum 5.47 long. 4.83 wide, three pairs of sigilla present, two anterior pairs small, anterior one closer to margin than median one, posterior pair of sigilla large, medially fused.

Measurements of palp: 13.95 (5.28, 2.41, 3.05, 3.21). Legs relatively short and robust, without scopula. Measurements of legs: I 15.98 (5.68, 2.78, 3.59, 2.34, 1.59), II 14.02 (4.92, 2.27, 2.94, 2.18, 1.71), III 13.65 (4.79, 2.59, 2.04, 2.35, 1.88), IV 16.59 (5.39, 2.73, 2.92, 3.24, 2.31). Leg formula 4213. Palpal claw with one proximal tooth on common base and one denticle slightly closer to front base of that tooth, the tooth with one small denticle each front and back surface. Each claw of leg tarsus with one small denticle and one larger tooth near base. Spination: Palp, patella 1 pv distal spine, tibia pv 36/33, rv 35/37, tarsus pv 41/42, rv 57/50; legs I, tibia pv 29/22, rv 39/31, metatarsus pv 40/38, rv 44/35, tarsus pv 27/26, rv 19/21; II, tibia pv 14/11, rv 11/15, metatarsus pv 34/30, rv 19/16, tarsus pv 25/23, rv 10/11; III-IV with many pd and distodorsal spines on patellae and tibiae, d and pd spines on metatarsus III and pd spines on metatarsus IV, 5/4 pd distal spines on metatarsus III, 12/14 pd to ventral distal spines on tarsus III, some of spines on Legs III-IV difficult to distinguish from stiff bristles.

Trichobothria: Palp, tibia with 3 pd, 2 rd in proximal half, tarsus with 8/9 pd (one of trichobothrial sockets carrying two trichobothria on right metatarsus), arranged on irregular oblique row; Legs I, tibia with 4 pd, 4 rd in proximal half, metatarsus with 6 d in distal half, tarsus with 13/14 d, irregularly arranged; Legs II-IV share similar trichobothrial position and arrangement to I; II, tibia 4 pd, 4 rd, metatarsus 6/5 d, tarsus 14/15 d; III, tibia 3/4 pd, 3 rd, metatarsus 6/5 d, tarsus 14/18 d; IV, tibia 5 pd, 5 rd, metatarsus 5 d, tarsus 9 d.

Opisthosoma 9.15 long. Opisthosomal disc 11.33 in diameter, carrying ca. 35 bristles on each rib angle, with three pairs of muscle impressions centrally, two longitudinal ribs separating upper muscle impressions from each other, two transversal ribs separating upper and median pair of muscle impressions, ends of lower transversal rib not connected to radial ribs, ribs between muscle impressions slightly fragmentised; with 45 radial ribs around muscle impressions, each rib carrying tubercles in one row and many adjacent smaller rough granulations irregularly arranged besides the tubercles; no setae present on disc surface, except for three pairs of bristles on rims of muscle impressions (upper pair on inner lower corner of rim of upper muscle impressions, median pair on inner median part of rim of median muscle impressions and lower pair on inner upper part of rim of lower muscle impressions) (Fig. 5 C). Posterior median spinnerets 1.25 long, posterior lateral spinnerets 3-segmented (Fig. 4 J), 2.15 long.

Spermathecae long, distally curved inwards, ental margin concave near mid-point; with dense pores (Fig. 7 A, 9C).

Male (Paratype, MHBU-ARA-00023660). Sclerotised parts of body mostly reddish-black, membranes cream, leg tarsi slightly lighter than other segments (Fig. 2 A-B). Opisthosoma yellowish-brown, ribs slightly darker (Fig. 4 A-B). Total length (not including chelicerae) 16.50. Carapace 7.03 long, 6.29 wide, rather rough, with some transverse ridges on cephalon and dense pits. Eyes on low mound (Fig. 4 G), eye group 0.78 long, 1.98 wide anteriorly, 1.90 wide posteriorly. Eye diameters and interdistance: AME 0.44, ALE 0.42, PME 0.32, PLE 0.28, AME-AME 0.18, AME-ALE 0.26, ALE-PLE 0.24, PME-PME 0.82, PME-PLE 0.06, MOA 0.81 long, front width 1.03, back width 1.29. Chelicerae relatively weaker than female, promargin of cheliceral groove with 13/15 and retromargin with 11/10 denticles of different sizes. Rastellum carrying one retrolateral-proximal spine and 7/6 distal spines. Maxillae 3.16 long, 1.65 wide, carrying 10 cuspules in prolateral-proximal corner. Labium 1.07 long, 1.54 wide, carrying two cuspules. Sternum 5.47 long. 4.83 wide, with three pairs of sigilla (Fig. 4 E) like female in position and shape.

Measurements of palp: 14.33 (5.58, 2.52, 4.51, 1.72). Legs relatively short and robust, all tarsi present scopula. Measurements of legs: I 22.14 (7.33, 2.60, 5.27, 4.66, 2.28), II 19.43 (6.12, 2.57, 4.27, 4.26, 2.21), III 18.18 (5.47, 2.69, 3.16, 4.20, 2.66), IV 23.30 (6.68, 3.31, 4.46, 5.84, 3.01). Leg formula 4123. Claws of leg tarsus like female. Leg spination: I, tibia pv to rv 19 (pv 3, distally), metatarsus pv to rv 20, tarsus pl to pv 14/13, v 1/2, rv 11/8; II, tibia pv to rv 19, metatarsus pv to rv 25, tarsus pl to pv 11/13, v 2/3, rv 20/21; III-IV with many spines (Fig. 10 A), but none on dorsal and retrolateral sides of tibiae III-IV and retrolateral side of metatarsus IV, most spines on legs III-IV difficult to distinguish from stiff bristles.

Trichobothria: Palp, tibia with 5 d in proximal half, cymbium with 7/6 d in distal half, arranged in an irregularly oblique row; Legs I, tibia with 4 pd, 4 rd in proximal half, metatarsus with 5 d in distal half, tarsus with 19/14 d, irregularly arranged; Legs II-IV share similar trichobothrial position and arrangement to I; II, tibia 4 pd, 4 rd, metatarsus 5/6 d, tarsus 16/14 d; III, tibia 4/3 pd, 4 rd, metatarsus 3 d, tarsus 17/15 d; IV, tibia 4 pd, 4 rd, metatarsus 4/5 d, tarsus 8/7 d.

Opisthosoma 8.05 long, disc 7.94 in diameter, with ca. 30 bristles on each rib angle (Fig. 11 A). Muscle impressions and ribs between muscle impressions as in female, but not strongly sclerotised; 45 radial ribs present (Fig. 5 A), without tubercles. Bristles of disc like female in number and position. Posterior median spinnerets 1.00 long, posterior lateral spinnerets 3-segmented (Fig. 4 I), 2.77 long.

Embolus slender, tapering gradually into a fine tip that widens at its tip, to form a hook-like structure (Fig. 6 D).

Juveniles. First instar spiderling (Fig. 8 D-F): body length 2.68 (not including chelicerae), carapace 0.96 long, 0.87 wide, abdomen oval, without opisthosomal disc, but three upper pairs of impressions (rows of impression I-III) and two lower unpaired transverse impressions (rows of impression IV-V) posteriorly (Fig. 8 E-F); rastellum absent, front surface of chelicerae carrying one row of small spines. Second instar spiderling (Fig. 8 G-J): body length 3.17 (not including chelicerae), carapace 1.01 long, 0.96 wide, opisthosomal disc present, with ca. 40-45 radial ribs, carrying one bristle on each rib angle, upper muscle impressions kidney shaped (with elevated subcentral zone) (Fig. 8 J); rastellum present, carrying one retrolateral-proximal spine and one distal spine (Fig. 8 I). Subadult male (penultimate) like female in overall appearance and disc pattern, but palpal tarsi swollen proximally.

Variation between adults (both sexes). Count of radial ribs on female disc: 42-46 (n = 4); count of radial ribs on male disc: 44-48 (n = 2). Outlines of tip edges of embolus are slightly different in two males: relatively protracted in one, whereas relatively blunt in another one; apophysis of embolic tip show different sizes amongst two individuals (Fig. 6 D-E). No obvious variation of embolic details observed between two palps in same individual.

Diagnosis

The new species can be distinguished from the American congeners, Cyclocosmia loricata (C. L. Koch, 1842), C. torreya Gertsch & Platnick, 1975 and C. truncata (Hentz, 1841), by the more dense pores on spermathecae and the tips of spermathecae not processing lateral lobes (Fig. 7 A-B, Fig. 9 C-F), whereas the pores are relatively sparse and the lobes are well developed in the latter three species (see Gertsch and Platnick (1975): figs. 25-27).

In females, the new species can be distinguished from all Asian congeners (except for C. lannaensis Schwendinger, 2005) by the presence of tubercles on radial ribs (Fig. 5 C-D) and spermathecae distally curved inwards (Fig. 7 C-F, Fig. 9 C-F). However, females can be distinguished from C. lannaensis by the following: (1) surface of radial ribs rather rough, with large number of small granulations (Fig. 12 A); and (2) the lower transversal rib between upper and median muscle impressions is separated from radial ribs (Fig. 5 C-D, 12A); whereas in C. lannaensis , surface of radial ribs is relatively smooth, without small granulations (Fig. 12 B; Schwendinger (2005): fig. 51), the lower transversal rib between upper and median muscle impressions is connected to radial ribs (Fig. 12 B; Schwendinger (2005): fig. 49). Further, females of the new species can also be distinguished from C. siamensis Schwendinger, 2005 by the absence of setae on the radial ribs (Fig. 5 C-D), whereas setae are well developed on the radial ribs of disc in C. siamensis (see Schwendinger (2005): figs. 23-24). Females can be further distinguished from C. ricketti (Pocock, 1901) and C. subricketti Yu & Zhang, 2018 by: (1) the reduced number of radial ribs (count = 42-46); (2) absence of many small bristles on the clypeus (Fig. 9 A), whereas in the latter two species, more than 60 radial ribs are present on the opisthosomal disc (Fig. 12 C; Yu and Zhang (2018): fig. 5G) and many small bristles are present on clypeus (Fig. 9 B; Schwendinger (2005): fig. 2). Females can be further distinguished from both C. latusicosta and C. liui Xu, Xu & Li, 2017 by the absence of an elevated central zone in either the upper or median pair of muscle impressions (Fig. 5 C-D), whereas these are present in the upper muscle impressions of C. latusicosta forming endocentric concavities (Fig. 12 D; Zhu et al. (2006): fig. 6B); or present in the median muscle impressions of C. liui ( Xu et al. (2017): 83, fig. 3C).

In males, the new species can be distinguished from C. latusicosta , C. ricketti , C. sublatusicosta and C. subricketti by the following: (1) the presence of scopula on ventral tarsi IV (Fig. 10 A); and (2) presence of more setae irregularly arranged on the dorsal abdominal ribs (Fig. 11 A), whereas in C. latusicosta , C. ricketti , C. sublatusicosta and C. subricketti , the scopula is absent on ventral tarsi IV (Fig. 10 B), the dorsal abdominal ribs have only a row of sparse setae only similarly dense distally (Fig. 11 B). Males of the new species can be further distinguished from C. ricketti , C. sublatusicosta and C. subricketti by: (1) the reduced number of radial ribs (count = 44-48) (Fig. 5 A-B); (2) in prolateral view, the apophysis of the embolic tip points laterally (Fig. 6 D-E), whereas in C. ricketti , C. sublatusicosta and C. subricketti , more than 60 radial ribs are present on the opisthosomal disc ( Lin et al. (2022): fig. 1D; Yu and Zhang (2018): figs 8B-C); while in prolateral view, the apophysis of the embolic tip points dorsally ( Lin et al. (2022): fig. 5D). Males can be further distinguished from C. latusicosta by the absence of the elevated central zone in the upper muscle impression (Fig. 5 A-B), whereas these are present in C. latusicosta (Fig. 12 D; Yu and Zhang (2018): fig. 8A). Additionally, males can be distinguished from C. lannaensis and C. siamensis by the lower transversal rib between upper and median muscle impressions being separated from radial ribs (Fig. 5 A), whereas in C. lannaensis and C. siamensis , the lower transversal rib between upper and median muscle impressions is connected to radial ribs ( Schwendinger (2005): figs. 28, 53).

Remark

Interspecific genetic distances (p -distance) on COI sequences between Cyclocosmia ruyi sp. nov. and five other Asian congeners ( C. lannaensis , C. latusicosta , C. ricketti , C. sublatusicosta and C. subricketti ) form the range from 12.61% to 15.04%, which is considered comparable to interspecific genetic distances between C. lannaensis , C. latusicosta and C. ricketti (13.19% between C. latusicosta and C. ricketti ; 14.84% between C. lannaensis and C. latusicosta ; 17.09% between C. lannaensis and C. ricketti ) and obvious higher than interspecific genetic distances between C. ricketti , C. sublatusicosta and C. subricketti (3.45 ~ 3.60% between C. sublatusicosta and C. ricketti ; 6.30 ~ 6.45% between C. ricketti and C. subricketti ; 6.60 ~ 6.90% between C. subricketti and C. sublatusicosta ). Interspecific genetic distances between C. ruyi sp. nov. and two American congeners ( C. loricata and C. truncata ) form the range from 15.17% to 22.86%, considered comparable to interspecific genetic distances between other Asian Cyclocosmia species and American Cyclocosmia species (15.59 ~ 23.69%; Table 2 ).

Etymology

The specific epithet is from the Chinese " 如意” ( rú yì), it is an auspicious blessing, meaning "everything goes well"; noun in apposition.

Biology

All specimens were collected from moist slopes beside path cuts or hillside with abundant leaf litter (Fig. 1 B). Burrows are usually with moss nearby. The entrance of burrow is closed by a thin trapdoor comprised of dead leaves, twigs and moss, sometimes with an extended rim (Fig. 1 C-D). The burrow internally presents a wide upper and median portion (vestibule) and a constricted basal tube (Fig. 1 E). Burrows of adult females are ca. 7-11 cm deep, shallower in juveniles.

Two mature males were obtained in early October, one matured in captivity from a subadult collected earlier (MHBU-ARA-00023660); another one was collected from the wild (MHBU-ARA-00023658). The collection of dust and soil on the body, shrunken abdomen and abrasion of some claws, indicate the latter one had perhaps been mature for some time. Two females were observed each carrying one egg sac on 3-4 August 2022. Daytime temperatures on those days ranged from a maximum of 30°C to a minimum of 20°C at night (perhaps relatively stable inside the burrow). When burrows were excavated, those females first tried to threaten by biting, before retreating to the constricted basal tube and blocking it with their abdominal disc, but leaving their egg sac behind themselves (Fig. 1 F-G).

Two egg sacs were soon opened by the first author in the laboratory (10 August 2022). One of them had 147 live first instar spiderlings and same number of eggshells (Fig. 3 A-B), the other had 158 fresh dead first instars, some eggshells and four eggs ready to hatch (this latter sac may have been ruined by accidental extrusion during carriage); no unfertilised eggs found. Living spiderlings were placed in a sunless incubator with 27°C and 95% humidity to nurture. After ca. 3-4 weeks (1-6 September 2022), they started to moult into second instars (Fig. 3 C-E). The practical period of first instar stage is unknown, because the hatching time is uncertain, but presumably not too much longer.

First instar spiderlings present a few of small spines on the front surface of the chelicerae, which do not seem homologous to those of the rastellum because of their deviation in position, arrangement and shape. These spines were developed before the hatching (Fig. 8 C) and partly missing in some emerged first instars, which indicates they may be potentially used to puncture the eggshell. The opisthosomal disc was shaped up after moulting to second instar, three pairs of muscle impression were positionally corresponding to rows of impression II-IV in first instar; rows of impression I and V of first instar disappeared after moulting into second instar. These spiderlings seem very sensitive to light (even in early stage of first instar when their eyes were not well developed), they were very agitated under artificial lighting, but soon regained their sedentary composure after lighting was removed.

Distribution

Known only from the type locality of Guangxi, China (Fig. 13 ).

DNA barcode

AGATATTGGAACTCTTTATTTAATGTTTGGGGTTTGAGCTTCTATAATGGGTTCAGGTATAAGATTAATTATTCGAACTGAGTTAGGCCAATTAGGGAGATTTTTAGGTGATGATCATTTATATAATGTTATTGTGACAGCACATGCTTTAGTAATGATTTTTTTTATAGTGATGCCTATTATGATTGGGGGATTTGGAAATTGGTTGGTTCCTTTAATGATAGGGGCTCCAGATATAGCTTTTCCTCGGATGAATAATTTAAGATTTTGGTTATTGCCTCCTTCTTTGTTTATGTTGTTGCTTTCTTCTTTGACTGATTTAGGGGTAGGAGCTGGATGGACTATTTATCCTCCATTGTCTTCTTCTTTGGGGCATATAGGGGGGGGGATAGATTTTGTTATTTTTTCTTTGCATTTGGCAGGGGCTTCTTCAATTATAGGGGCTATTAATTTTATTTCAACTATTGTGAATATACGATCTTCTGGAATGAGTTTGGAACGAGTTCCTTTGTTTGTGTGATCTGTGATGATCACAGCTATTTTATTGTTATTGTCGTTACCAGTTTTAGCTGGAGCGATTACTATATTGTTGACTGACCGGAATTTTAATACTTCTTTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATTTCASCATTTATTTTGATTTTTTGGTC (GenBank accession number: OQ561524)

Figures

Figure 1. Habitats (A-B) and burrows (C-E) of Cyclocosmia ruyi Yu & Zhang sp. n. A Landscape of type locality; B Microhabitat; C-D Burrow of holotype female, trapdoor closed (C) and opened (D); E Profile of burrow of paratype female (MHBU-ARA- 00023657), with arrows indicating constricted basal tube; F-G Holotype female using opisthosomal disc as the false bottom of burrow, with egg sac (F) and egg sac removed (G). Figures are copyright 2023 Kun Yu.

Figure 2. Living specimens of Cyclocosmia ruyi Yu & Zhang sp. n.. A-B Paratype male (MHBU-ARA- 00023660); C-F Holotype female. A-E Copyright 2023 Weihang Wang; F Comparison of female and egg sac, copyright 2023 Kun Yu.

Figure 3. Living spiderlings of Cyclocosmia ruyi Yu & Zhang sp. n. A First instar spiderlings in egg sac; B first instar spiderlings, with eggshells; C Late stage of a first instar spiderling, pre-moult; D Second instar spiderlings, back view; E Comparison.

Figure 4. Cyclocosmia ruyi Yu & Zhang sp. n.. A-B, E, G, I Paratype male (MHBU-ARA- 00023660); C-D, H Paratype female (MHBU-ARA- 00023657); F Paratype female (MHBU-ARA- 00023659); J Holotype female; A-D Habitus; E-F Sternum; G Ocular area; H Bristles on clypeus; I-J Spinnerets. A, C, G-H Dorsal view; B, D, E-F, I-J Ventral view.

Figure 5. Opisthosomal discs of Cyclocosmia ruyi Yu & Zhang sp. n.. A Paratype male (MHBU-ARA- 00023660); B Paratype male (MHBU-ARA- 00023658); C Holotype female; D Paratype female (MHBU-ARA- 00023659).

Figure 6. Cyclocosmia ruyi Yu & Zhang sp. n., palp of paratype males. A-C, E MHBU-ARA- 00023658; D MHBU-ARA- 00023660; D-E Details of embolic tip in two individuals.

Figure 7. Cyclocosmia ruyi Yu & Zhang sp. n., vulvae of females. A Holotype; B Paratype (MHBU-ARA- 00023657).

Figure 8. Cyclocosmia ruyi Yu & Zhang sp. n., egg and early stages of spiderlings. A-C Pre-hatching egg; D-F First instar spiderling; G-J Second instar spiderling; C Chelicerae of embryo, with arrow indicating row of spines; I Chelicerae; J Opisthosomal disc. A, C, I Front; B, F Lateral; D, G Dorsal; E, H Ventral; J Back.

Figure 13. Distribution records of Cyclocosmia species in Asia.