Aguna mcguirei Grishin, 2023

Zhang, Jing, Cong, Qian & Grishin, Nick V., 2023, Thirteen new species of butterflies (Lepidoptera: Hesperiidae) from Texas, Insecta Mundi 2023 (969), pp. 1-58 : 32-34

Aguna mcguirei Grishin , new species

https://zoobank.org/ F99C0D22-EDB9-4FBB-9195-6A5CC88C9A85

( Fig. 27 part, 28, 29a, b, 30)

Definition and diagnosis. Genomic sequencing of Aguna metophis (Latreille, [1824]) (type locality in Brazil) reveals that North American specimens, including one from the US, cluster together and away from a specimen from Brazil: Rio de Janeiro in both nuclear and mitochondrial genes ( Fig. 27 ). Their COI barcodes are 2.4% (16 bp) different, including specimens from Brazil: Rondônia not shown in genomic trees but having barcodes only 1 bp different from the Rio specimen. This genetic differentiation combined with genetic uniformness within each group across their ranges suggests that North American specimens are a species distinct from Brazilian A. metophis , and because there is no available name to assign to them, represent a new species. This new species keys to A. metophis (C.5.11) in Evans (1952) and differs from it by typically narrower pale discal band on ventral hindwing ( Fig. 28 , 29a, b ), in particular, the streak in cell CuA 2 -1A+2A is mostly narrower and smaller than in A. metophis ( Fig. 29c, d ); forewing hyaline spots are usually larger (although some A. metophis possess large spots as well) and less angular, and the spot in the cell CuA 1 -CuA 2 is not as strongly hourglass-like as in A. metophis , who also frequently has corners of this spot extending distad (most strongly along the vein CuA 2) into a sharp triangle, mostly lacking in the new species; uncus arms are longer (comparatively to the tegumen length) than in A. metophis , the gnathos is shorter, the ventral margin of valva is more concave in the middle, the dorsal tooth of the harpe (near ampulla) is large and more prominent, the harpe is more extended and pointed distally. Phenotypic differences from A. metophis are rather subtle and, therefore, confident identification is made by DNA characters: a combination of the following base pairs is diagnostic in nuclear genome: aly283.2.7:A147C, aly283.2.7:T141A, aly686.41.7:A132C, aly164.1.4:G95A, and aly16576.4.6:C654T, and COI barcode: T85C, T212C, T340C, T346C, T562C, and T574A.

Barcode sequence of the holotype. Sample NVG-5526, GenBank OP762108, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCTGGATTAATTGGAACTTCTTTAAGATTACTTATTCGTACTGAATTAGGTACCCCCGGAT CTTTAATTGGTGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGG AGGATTTGGAAATTGATTAATTCCTTTAATACTAGGAGCCCCAGATATAGCATTCCCTCGAATAAATAATATAAGATTTTGACTTTTAC CCCCTTCTTTAACTCTTTTAATTTCTAGAAGTATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTACCCCCCCCTTTCTTCTAA TATTGCTCATCAAGGAGCTTCTGTAGATTTAGCAATTTTCTCTTTACATTTAGCAGGAATTTCTTCTATTCTTGGAGCTATTAATTTTA TTACAACAATTATTAATATACGAATTAATAATTTATCATTTGATCAAATATCTTTATTTATTTGAGCAGTTGGAATTACAGCTTTATTATT ATTACTTTCTTTACCAGTTTTAGCCGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACATCATTTTTTGATCCAGCAGGAGG AGGAGATCCTATTCTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the Texas A&M University Insect Collection, College Station , Texas, USA ( TAMU), illustrated in Fig. 28 , 30 bears the following six rectangular labels, five white: [TEXAS: | CAM- ERON COUNTY | Brownsville], [coll. | 20 Oct 1973 | W. W. McGuire], [ HESPERIIDAE , | Pyrginae: | Aguna metophis | (Latreille, [1824]) | det. R. O. Kendall | ♂ M. & B. No. 15], [DNA sample ID: | NVG-5526 | c/o Nick V. Grishin], [genitalia | NVG160110-62 | Nick V. Grishin] and one red [HOLOTYPE ♂ | Aguna mcguirei | Grishin] . Paratypes: 6♂♂ and 6♀♀: USA: Texas: 1♀ NVG-19013E12 Galveston Co., Galveston , 7-Aug-1973, W. W. McGuire leg. [ TAMU] ; Hidalgo Co.: 1♀ NVG-15091H07 Madero , ex egg ex ♀ 6-Nov-2005, reared on Bauhinia mexicana , eclosed 17-Feb-2006, R. W. Boscoe leg. [ MGCL] ; 1♀ NVG-15091H08 McAllen , 1-Oct-1972, F. D. Fee leg. [ MGCL] ; 1♂ NVG-15105A07 Santa Ana National Wildlife Refuge , 5-Nov-1972, J. W. Tilden leg. [ CAS] ; Mexico: 1♂ NVG-5506 Tamaulipas, nr. Los Kikos, Gonzales, Ranch , ex larva coll. 1-Jan-1975 on Bauhinia mexicana, R. O. Kendall and C. A. Kendall leg., genitalia NVG160110-43 [ TAMU] ; 1♀ NVG-19013F01 San Luis Potosi, El Salto Falls , 24-Dec-1972, R. O. Kendall and C. A. Kendall leg. [ TAMU] ; Sinaloa: Mazatlan, Aug [old], Kusche leg. [ USNM]: 1♂ NVG-5042, genitalia NVG151101-93 ; 1♀ NVG-5043, genitalia NVG151101-94; 1♂ NVG-15105A08 Yucatan, Piste , 18-Sep-1959, E. C. Welling leg. [ CAS] ; Costa Rica 1♂ NVG-17098B11, 05- SRNP-41056, Area de Conservación Guanacaste, Alajuela Prov., Sector Rincon Rain Forest , ex larva, eclosed on 21-May-2005, Minor Carmona leg., genitalia X-6837 J. M. Burns 2010 [ USNM] ; Panama: Canal Area, Paraiso , G. B. Small leg. [ USNM]: 1♂ NVG-5039 16-Jul-1978, genitalia NVG151101-90 ; 1♀ NVG-5044 27-Jun-1977, genitalia NVG151101-95.

Type locality. USA: Texas, Cameron Co., Brownsville.

Etymology. Named in honor of William W. McGuire, the collector of the holotype (and also the northernmost paratype, from Galveston in Texas), whose contributions to lepidopterology cannot be overstated, starting from many new butterfly records ( McGuire and Rickard 1976), collecting the holotypes of five species described in this work (one more is collected by Nadine M. McGuire), and his illustrious taxonomic studies, particularly on Hesperia , to the establishment and most generous support of the premier institute for the studies of Lepidoptera , the McGuire Center. The name is a noun in the genitive case.

English name. McGuire’s Aguna .

Distribution. From the Lower Rio Grande Valley in South Texas to Panama.

Comment. Although proper Latinization may call for replacing “mc” with “mac” in the species epithet ( Vendetti and Garland 2019), to avoid confusion of people who may not be familiar with this tradition and keeping the spelling consistent, the original “mc” was not altered.

Figures

Figure 27. Trees of Aguna metophis group constructed from protein-coding regions in a) Z chromosome and b) mitochondrial genome: A. mcguirei sp. n. (red), and E. metophis (blue). The holotype is labeled in magenta. See Fig. 1 legend for other notations.

Figure 28. Holotype of Aguna mcguirei sp. n. dorsal (left) and ventral (right) views, data in text.

Figure 29. Two species of Aguna, iNaturalist observations. a–b) A. mcguirei sp. n. USA: TX, Hidalgo Co: a) 110235614 Estero Llano Grande State Park, 5-Nov-2014 © Mark + Holly Salvato. b) 123646178 Mission, 1- Nov-2012 © John Rosford. c–d) A. metophis. c) 130511769 Brazil: Minas Gerais, 12-Aug-2022 © Carlos Otávio Gussoni.d) 122340621 Brazil: São Paulo, Rio Claro, 7-Jan-2020 © Carlos Otávio Gussoni. Some images are colorcorrected, rotated, and/or flipped. CC BY-NC 4.0 https://creativecommons.org/licenses/by-nc/4.0/.

Figure 30. Genitalia of Aguna mcguirei sp. n. holotype (data in text) in different views. a) left lateral, b) left posterolateral, c) ventral, d) dorsal.