Hesperia balcones Grishin, 2023

Zhang, Jing, Cong, Qian & Grishin, Nick V., 2023, Thirteen new species of butterflies (Lepidoptera: Hesperiidae) from Texas, Insecta Mundi 2023 (969), pp. 1-58 : 42-46

Hesperia balcones Grishin , new species

https://zoobank.org/ D8965D03-EFD6-4958-802C-C08F42FC86E4

( Fig. 43 part, 44, 45a–d, 46a–d, 47)

Definition and diagnosis. Genomic analysis of Hesperia woodgatei (Williams, 1914) (type locality in USA: New Mexico, Los Alamos Co., Jemez Mts.) across its range reveals a prominent split into two clades. One clade ( Fig. 43 blue) included a syntype of H. woodgatei ( Fig. 43 magenta) and in addition to the specimens from the USA (New Mexico and Arizona) there were also specimens from Mexico (Coahuila). The other clade ( Fig. 43 red) consists of the central Texas populations. Fst / Gmin statistics for their comparison are 0.39/0.006, suggesting that the two clades correspond to distinct species. COI barcodes differ between them by 1.2% (8 bp). In contrast, Fst / Gmin between populations of H. woodgatei ( Fig. 43 blue) from the US and from Mexico are 0.13/0.06, suggesting that they are conspecific. The red clade does not have an available name associated with it and therefore represents a new species. The new species is similar to H. woodgatei and keys to it (M.10.2) in Evans (1955), but differs in having browner and grayer (instead of more greenish) ventral side of wing with typically smaller spots, especially on the forewing ( Fig. 44 , 45a–d ); in male genitalia ( Fig. 46a, b, e, f ), the tegumen with uncus is smaller and shorter, broader in dorsal view and narrower towards the base in lateral view; the saccus is shorter and broader (the shape and number of valval teeth appears to be an individually variable character); in female genitalia ( Fig. 46c, d, g, h ), the lamella postvaginalis is straighter and mostly convex along its distal margin and not with protruding central more sclerotized area concave in the middle, as in H. woodgatei . In DNA, a combination of the following base pairs is diagnostic in nuclear genome: aly1603.68.1:G108A, aly5294.15.2:C156T, aly6841.61.2:G318A, aly315.1.25:C75T, and aly151.14.4:C48A, and COI barcode: T118T(not C), T235T(not C), T274T(not C), and T287T(not C).

Barcode sequence of the holotype. Sample NVG-22031H10, GenBank OP984704, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGTATATTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGAT CTTTAATTGGAGATGACCAAATTTATAATACTATTGTCACAGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTG GAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCACGTATAAATAATATAAGATTTTGAATATTA

CCCCCTTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTACTGGAACAGGTTGAACTGTTTATCCCCCTTTATCTTCTA ATATTGCTCATCAAGGATCTTCTGTTGATTTAACAATTTTTTCTCTTCATTTAGCTGGAATTTCATCTATTCTAGGAGCTATTAATTTTA TTACAACAATTATTAACATACGAATTAAAAATTTATCTTTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCATTATTATT ACTTTTATCTTTACCTGTATTAGCAGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACTTCTTTTTTCGATCCAGCAGGAGG AGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History , Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 44 , bears the following 3 rectangular labels, 2 white: [ USA: Texas, Travis Co. | Volente, along Lime Creek Rd. | between 30.4611, −97.9064 | and 30.4605, −97.9011 | 9-Oct- 2008 N. V. Grishin leg.], [DNA sample ID: | NVG-22031H10 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Hesperia | balcones Grishin ] . Paratypes: 17♂♂ and 27♀♀: USA: Travis Co.: the type locality, N. V. Grishin leg.: 2♂♂ 9-Oct-2005 ; 2♂♂ and 2♀♀ 6-Oct-2007 ; ex ♀ ex ovum, 1♂ eclosed 9-Feb-2008; 1♂ NVG-22031H11, 4♂♂, and 12♀♀ 9-Oct-2008; ex ♀ ex ovum, eclosed: 1♀ 27-Feb-2009, 1♂ 6-Mar-2009, 1♀ 21-Mar-2009; Volente, W. R. Dempwolf leg.: 1♀ NVG-17113 E04 30 -Sep-2016, GenBank accession OP762112 ; 1♂ NVG-17113 E09 6 -Oct-2017; 1♂ NVG-17113 E08 7 -Oct-2016; 1♀ NVG-17113 E05 7 -Oct-2016; Austin , FM2769 nr. Bullick Hollow Rd., N. V. Grishin leg.: 30.4410, −97.8696: 3♀♀ 9-Oct-2005 ; ex ♀ ex ovum, eclosed: 1♂ 18-Apr-2006, 1♀ 27-Apr-2006; 30.44033, −97.87318: 1♀ 9-Oct-2005; 1♂ and 2♀♀ 9-Oct-2008 ; Bee Cave Rd. , ca. 9 mi WNW of Austin, 10-Oct-1976, R. O. Kendall and C. A. Kendall, leg. [ TAMU]: 2♂♂ NVG-19012H10 and NVG-19012H11, 1♀ NVG-19012H1 ; and 1♀ NVG-19071E02 Kerr Co., [probably Lacey’s ranch,] about 1900, Barnes Collection [ USNM]. Reared specimens developed continuously without diapause and aestivation, and eclosed during spring the following year, which is unnatural. In nature, there is only one flight in the fall, not spring .

Type locality. USA: Texas, Travis Co., Volente, along Lime Creek Rd. between GPS 30.4611, −97.9064 and 30.4605, −97.9011.

Etymology. The name is for the Hill Country that contains the entire distribution of this species: an area in Central Texas bounded on the east by the Balcones Fault. In 1756, Bernardo De Miranda, a Spanish explorer, named this formation “Los Balcones”, meaning “Balconies” ( Spearing 1991). Limestone cliffs and hills of the Balcones Escarpment is the habitat of this species. The name is a masculine noun in apposition.

English name. Hill country skipper.

Distribution. Currently known only from central Texas, USA.

Life history. While we have not observed immature stages in nature, we reared this species from eggs laid by captive females. White eggs were placed singly on living or dry leaves and stems of grasses ( Fig. 47a, b ). Feeding on Cynodon dactylon (L.) Pers. (for convenience of access to this grass), caterpillars are greenish with jet-black head and collar in the first two instars ( Fig. 47c–f , cream-colored before starting to feed), turning brown towards maroon-purple with white neck, and from the 3 rd instar developing a pair of yellowish vertical stripes on the forehead ( Fig. 47g –l ). In the laboratory conditions, caterpillars did not undergo diapause or aestivation and pupated after six instars. Pupa pale, cream-colored with brown mottled pattern and pinkish abdomen ( Fig. 47m –o ).

Figures

Figure 43. Trees of Hesperia woodgatei group constructed from protein-coding regions in a) nuclear and b) mitochondrial genomes: H. balcones sp. n. (red) and H. woodgatei (blue). A syntype is labeled in magenta. See Fig. 1 legend for other notations.

Figure 44. Holotype of Hesperia balcones sp. n. dorsal (left) and ventral (right) views, data in text.

Figure 45. Two species of Hesperia from the USA. Numbers are given for iNaturalist observations. a–d) H. balcones sp. n., Texas. a) 99404027 Burnet Co., Balcones Canyonlands National Wildlife Refuge, 17-Oct-2021 © Jack Cochran. b–c) Travis Co. Volente, 6-Oct-2007 © Nick V. Grishin. d) 2146572 Burnet Co., Balcones Canyonlands National Wildlife Refuge, 16-Oct-2015 © Roger Shaw. e) H. woodgatei 16707845 NM: Crant Co., Lake Roberts, 16-Sep-2018 © Bill Carrell. Some images are color-corrected, rotated, and/or flipped. CC BY-NC 4.0 https:// creativecommons.org/licenses/by-nc/4.0/.

Figure 46. Genitalia of Hesperia. a–d) H. balcones sp. n. paratypes, data in text: a–b) NVG-22031H11 ♂ and c–d) NVG-19071E02 ♀. e–h) H. woodgatei from USA: New Mexico [USNM]: e–f) NVG-19071D12 ♂ topotype, Jemez Springs, 7000 ft, Aug-1930, J. Woodgate leg. and g–h) NVG-19071E01 ♀ Eddy Co., Guadalupe Mountains National Park, N McKittrick Canyon, 1-Oct-1983, S. J. Cary leg., in different views: a, e) right lateral, b, f) dorsal, c, g) ventral, d, h) right lateral. Female genitalia (corpus bursae is not shown) are slightly reduced (smaller scalebar) compared to male genitalia (larger scalebar).

Figure 47. Immature stages of Hesperia balcones sp. n. from the type locality. a–b) An egg in different views, 22- Oct-2007. c–l) Caterpillars of different instars: 1st [c) 22-Oct-2007, d–e) 21-Oct-2007], 2nd [f) 8-Nov-2007], 3rd [g) 18-Nov-2007], 4th [h) 26-Nov-2007, i) 3-Dec-2007], 5th [j) 3-Dec-2007, k) 22-Dec-2007], 6th [l) 10-Jan-2008]. m–o) A pupa in different views, 26-Jan-2008: m) dorsal, n) ventral, o) right lateral. All images are to scale.