Autochton caballo Grishin, 2023

Zhang, Jing, Cong, Qian & Grishin, Nick V., 2023, Thirteen new species of butterflies (Lepidoptera: Hesperiidae) from Texas, Insecta Mundi 2023 (969), pp. 1-58 : 27-29

Autochton caballo Grishin , new species

https://zoobank.org/ A49A7A6F-99C4-4405-8A50-E689FEAE9538

( Fig. 21 part, 22, 23a, b)

Definition and diagnosis. The Z chromosome tree reveals that in addition to Autochton reducta (Mabille and Boullet, 1919) (type locality in Venezuela) that we regard as a species ( Fig. 21 green), a possible sister to Autochton potrillo (Lucas, 1857) (type locality in Cuba) ( Fig. 21 blue), continental populations identified as A. potrillo form a clade of their own ( Fig. 21 red) thus constitute a distinct taxon. Fst / Gmin statistics for comparing the red and the blue clades are 0.31/0.009, but their COI barcodes do not show distinction: 0.3% (2 bp), even less so than those of A. reducta . Due to nuclear genome differentiation, the red clade represents a species distinct from A. potrillo , and differs from it by having larger hyaline spots on forewing ( Fig. 22 , 23a, b ), the discal cell spot is more saddle- (or horseshoe-) shaped, not broken into two spots as in many insular A. potrillo specimens ( Fig. 23c, d ) or much reduced as in A. reducta ( Fig. 23e ), both upper and lower shoulders of the spot are better developed; yellow overscaling is less extensive than in both A. potrillo and A. reducta , and the wings have less pebbly appearance as a result. Due to phenotypic variation, reliable identification is achieved by DNA characters: a combination of the following base pairs is diagnostic in the nuclear genome: aly16576.3.5:C27T, aly291.18.6:C69T,

aly259.28.6:T123C, aly 2007.4.2:A90G, and aly345.8.16:T81C, and COI barcode: T100T(not C), T250T(not C), and T364T(not C).

Barcode sequence of the holotype. Sample NVG-15101G06, GenBank OP762106, 658 base pairs:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAGTAGGTACTTCTTTAAGCTTATTAATTCGAACTGAATTAGGAACTCCTGGAT CATTGATTGGTGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTCTTTATAGTAATACCTATTATAATTG GAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCACCTGACATAGCTTTCCCCCGTATAAACAATATAAGATTTTGATTATTA CCCCCATCCCTAACTCTTTTAATTTCTAGTAGTATTGTAGAAAATGGTGCTGGAACAGGATGAACTGTTTATCCTCCTCTTTCTTCTAA TATTGCTCACCAAGGAGCTTCAGTTGATTTAGCAATTTTTTCCCTTCATCTTGCAGGTATTTCTTCTATTCTTGGAGCCATTAATTTTA TTACAACAATTATTAATATACGTGTTAATAATTTATCATTTGACCAAATACCTCTTTTCGTTTGAGCTGTAGGAATTACAGCTCTTCTTC TTTTACTTTCTTTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACCTCATTTTTTGATCCTGCAGGAG GAGGAGACCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History , Smithsonian Institution , Washington, DC, USA ( USNM), illustrated in Fig. 22 , bears the following three rectangular labels, two white: [Hidalgo Co., TEX. | 6 mi W of Hidalgo | 19/X/74 | - Wm McG.], [DNA sample ID: | NVG-15101G06 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Autochton | caballo Grishin ] . Paratypes: 3♂♂ and 2♀♀, in TAMU, collected by Roy O. Kendall and C. A. Kendall: USA 1♂ NVG-19013H09 Texas, Bexar Co., north of San Antonio near NE Preserve, 4-Apr-1959 ; Mexico: 1♀ NVG-19013H11 Nuevo Leon, Cola de Caballo , 23-Oct-1979 ; 1♂ NVG-19013H12 San Luis Potosi, EI Naranjo, 1-Mar-1976 ; 1♂ NVG-19013H10 Coahuila, Hwy 57 ca. 24 km ESE Saltillo at truck rest area, 15-Sep-1977 ; and in USNM 1♀ NVG-5715, 09-SRNP-57000 Costa Rica: Area de Conservación Guanacaste, Guanacaste Prov., Sector Mundo Nuevo , ex larva, eclosed on 29-Aug-2009, Mariano Pereira leg., genitalia NVG160214-76 .

Type locality. USA: Texas, Hidalgo Co., 6 mi W of Hidalgo.

Etymology. The name (horse in Spanish) is for the saddle- or horseshoe-shaped spot in the forewing discal cell in this sister of A. potrillo (foal), typically with a less developed spot. The name is a masculine noun in apposition.

English name. Caballo skipper.

Distribution. Continental species: from South Texas, USA to Costa Rica.

Epargyreus socus chota Evans, 1952 is a junior subjective synonym of Epargyreus clavicornis (Herrich-Schäffer, 1869)

Genomic sequencing of two syntypes of Eudamus clavicornis Herrich-Schäffer, 1869 (type locality from USA to Tropical America), in MFNB, reveals that they are closely clustered with Epargyreus socus chota Evans, 1952 (type locality in Trinidad) ( Fig. 24 orange). Their COI barcodes are 100% identical and the specimens are phenotypically similar. Therefore, we propose that Epargyreus socus chota Evans, 1952 , new synonym, is a junior subjective synonym of Epargyreus clavicornis (Herrich-Schäffer, 1869) . The type locality of E. clavicornis may be in Venezuela because E. socus chota has been recorded from Trinidad and Venezuela, and we are not aware of many mid-18 th century specimens collected in Trinidad.

Figures

Figure 21. Trees of Autochton potrillo group constructed from protein-coding regions in a) Z chromosome and b) mitochondrial genome: A. caballo sp. n. (red), A. potrillo (blue), and A. reducta (green). Primary type specimens are labeled in magenta. See Fig. 1 legend for other notations.

Figure 22. Holotype of Autochton caballo sp. n. dorsal (left) and ventral (right) views, data in text.

Figure 23. Three species of Autochton, iNaturalist observations.a–b) A. caballo sp. n. USA: TX, Hidalgo Co., Mission. a) 104493477 11-Nov-2017 © Mark + Holly Salvato. b) 116272640 22-Nov-2010 © John Rosford. c–d) A. potrillo. c) 57177194 Cuba: Guamá, 14-Aug-2020 © Alexis Felipe. d) 40695160 Dominican Republic: Hato Mayor del Rey, 7-Jan-2020 © djhiker. e) A. reducta 11287957 Colombia: Atlántico, Tubará, 3-Jan-2018 © djhiker. Some images are color-corrected and/or rotated. CC BY-NC 4.0 https://creativecommons.org/licenses/by-nc/4.0/.

Figure 24. Trees of Epargyreus constructed from protein-coding regions in a) nuclear and b) mitochondrial genomes: E. fractigutta sp. n. (red), E. cruza (blue), E. gaumeri (cyan), E. clavicornis (orange), E. clarus with E. huachuca (green), and E. zestos (purple) among their relatives (black). Primary type specimens are labeled in magenta. See Fig. 1 legend for other notations.