Hapalogenys bengalensis, Mohapatra, Anil, Ray, Dipanjan & Kumar, Vikas, 2013

Mohapatra, Anil, Ray, Dipanjan & Kumar, Vikas, 2013, A new fish species of the Genus Hapalogenys (Perciformes: Hapalogenyidae) from the Bay of Bengal, India, Zootaxa 3718 (4), pp. 367-377 : 368-376

Hapalogenys bengalensis sp. nov.

Proposed common name: Indian Velvetchin ( Figures 1–4 , Table 1 )

Holotype. MARC/ZSI/F3039 (87 mm SL), Digha Mohana, West Bengal, India (21°37.843'N, 87°32.827'E), 2 December 2012.

Paratypes. ZSI F-10839/2 (68 mm SL), Digha Mohana, West Bengal, India, same data as holotype; MARC/ ZSI/F3040 (4: 52–73 mm SL), Digha Mohana, West Bengal, India same data as holotype; MARC/ZSI/F3041 (4: 46–81 mm SL), Shankarpur, West Bengal, India (21.38.133N;87.34.417E), 21 January, 2013; MARC/ZSI/F3042 (4: 51–82 mm SL), Shankarpur, West Bengal, India (21° 38.133N, 87° 34.417E), 18 February 2013.

Diagnosis. A species of Hapalogenys with following combination of characteristics: Fleshy lowerlip with dense cluster of very small papillae anteriorly; 10 unobstructed pores on or behind chin, 3 longitudinal stripes on body irrespective of size of the specimen, their width below the base of 5th and 6th dorsal fin spines clearly wider than pupil diameter. Pelvic fin tip almost reaching beyond the first anal fin spine when depressed, sometimes reaching the second anal spine. Transverse scale rows 7–8 above lateral line, 19–20 below lateral line, gill rakers 7+ 11 in all specimens; soft rayed portion of dorsal and anal fins somewhat rounded.

Description. Body compressed, body depth 43.4–53.0% of SL, covered with ctenoid scales; mouth moderate with protractile upper jaw; chin with 10 pores, lower lips thick and fleshy with a cluster of very short, crowded papillae. Small, conical, pointed teeth uniformly present as band on both jaws, teeth in front of jaws enlarged but not caniform; vomer and palatines toothless. Orbit diameter slightly larger than interorbital space; suborbital depth less than eye diameter; posterior angle of jaw reaching vertical through the anterior most part of the eye. Head with scales, extending to snout tips, maxilla without scales, postero-ventral part of lower jaw with scales ( Fig. 2 ); cheek and opercular bones covered with scales; preopercle serrated; opercle with two short spines posteriorly; 7 branchiostegals present. Lateral line continuous to the hypural plate, pored lateral line scales 42–45; transverse scale rows above lateral line 7–8, 19–20 rows below lateral line; gill rakers 18 (7 on lower limb and 11on upper limb). Single, notched dorsal fin; 4th dorsal spine and 2nd dorsal soft ray longest; posterior part of soft dorsal fin rounded; a procumbent spine-like process present at origin of dorsal fin; second anal spine very strong, robust and longer than 3rd anal spine; posterior part of soft anal rays angular; pectoral-fin tip not reaching to anus; first soft rays of ventral fin filamentous and reaching beyond the base of first anal fin spine, sometimes reaching the base of second anal spine ( Fig.4 ); caudal fin rhomboid to rounded. Vertebrae 24. Proportional measurements of holotype and paratypes are given in Table 1 .

......continued on the next page

Colour. In fresh specimens, the head and body brown with three broad, longitudinal stripes; first from the front of dorsal-fin origin to the end of base of mid dorsal soft rays, second from nape to caudal-fin origin through the middle of caudal peduncle, and third from eye to caudal-fin base though lower end of caudal peduncle, the third stripe very broad at the anal-fin base, sometimes extending to the base of the anal fin; first and second stripes are almost parallel to each other; opercular flap silvery with yellowish sheen; all fins dark in fresh specimens, interspinous membrane of dorsal fin black in general but much darker in between the ninth to eleventh dorsal spines; dorsal spines white; dorsal soft rays portion black; tip of filamentous pelvic fin rays whitish; pectoral-fin base yellowish.

In preserved specimens, the colour is whitish-brown, the stripes faded and the opercular flap becomes dark. The colour of the soft rayed portions of all fins is faint.

Distribution. Presently known only from the West Bengal coast (of India) in the northern Bay of Bengal.

Etymology. The species is named as “ bengalensis ” with reference to the Bay of Bengal, where the species was collected.

Molecular results. The 653 base pair COI region from all the three specimens of new species (holotype and two paratype) were successfully sequenced. Further, analysis of these sequences along with COI sequences of all Hapalogenys species available (Accession numbers on tree) at GenBank revealed the 199 variable characters and 194 parsimony informative sites. Nucleotide frequencies were 28.51% (T), 17.67% (C), 24.24 (A) and 29.58% (G) and a slight A+T biasness (53%) as compared to C+G (47%) was observed. The overall transition (ti)/transversion (tv) bias of nucleotide sequence was R=5.049. The holotype and paratypes differs only in two nucleotide position. The mtCOI barcode profile of the Holotype is given below as an aspect of type description.

CTCTATTTAGTATTTGGTGCTTGAGCCGGCATGGTAGGCACTGCCCTTAGCCTACTTATCCGAGCAGAG CTCAGCCAACCTGGTGCTCTCCTAGGGGATGACCAAATCTACAATGTAATTGTTACAGCCCATGCATTT GTAATAATCTTTTTTATAGTTATACCCATTATGATTGGAGGATTCGGGAACTGACTAATTCCCCTCATGAT CGGGGCTCCTGACATGGCCTTTCCTCGAATAAATAATATGAGCTTCTGGCTCCTCCCTCCCTCTTTCCTT CTTCTCCTGGCCTCCTCCGGAGTAGAAGCAGGAGCCGGAACTGGATGAACCGTCTACCCGCCTCTAG CAGGCAACCTCGCCCATGCAGGAGCATCCGTCGATTTAACTATTTTCTCCCTTCACCTGGCAGGGGTG TCCTCAATTCTTGGAGCAATCAATTTTATTACAACTATCATTAACATAAAACCCCCTGCTATTTCCCAAT ATCAAACTCCCCTCTTCGTATGATCTGTCCTGATCACCGCCGTCCTCCTCCTTCTTTCACTCCCCGTCCT TGCCGCCGGCATCACTATGCTTCTAACAGACCGCAATCTAAACACAACCTTCTTCGACCCTGCAGGGG GAGGGGACCCAATCCTTTACCAACACCTGTT

The 3 specimens of Hapalogenys bengalensis sp. nov. used in this study clustered together ( Fig. 5 ) and considerably diverged from other species in Hapalogenys . The intraspecific sequence divergence of the new species is 0.000–0.003 as compared to interspecific genetic divergence ranging from 0.130–0.352 (Table 2). The genetic divergence between the new species and H. kishinouyei , which is most closely related, is 0.130–0.142, and clearly shows a “Barcoding Gap” using the maximum intraspecific divergence and minimum interspecific divergence (Meier et al. 2008). NJ tree analysis of the COI gene shows that all the previously sequenced species and sequences of three individuals formed monophyletic groups with strong bootstrap support (bootstrap value 100). The tree was divided into 3 clades and the new species H. bengalensis is clustered with H. kishinouye , showing their close relationship. Further, H. nigripinnis is sister to H. bengalensis / kishinouyei cluster ( Fig. 5 ).

For character based DNA Barcoding analysis, 29 unique diagnostic sites were observed for the new species ( Table 3 ).

Taxa Nucleotide position

(n) 35 44 122 212 269 272 290 299 317 335 341 377 Hapalogenys analis A C C T C A T A A T A (7) A (n = 8) C(1) Discussion

The new species Hapalogenys bengalensis is closely related to three species of the “ Hapalogenys kishinouyei complex”: Hapalogenys kishinouyei , H. dampieriensis and H. filamentosus ,a species group defined by having two to five longitudinal stripes on the body. Hapalogenys bengalensis differs from the other three species in having three longitudinal dark stripes, whereas H. dampieriensis has four stripes, H. kishinouyei five stripes and H. filamentosus two stripes. The number of scale rows above the lateral line are fewer (7–8) in Hapalogenys bengalensis than the other three species of the “ Hapalogenys kishinouyei complex” (10–12). Snout length of Hapalogenys bengalensis is also comparatively less than all other species of the “ Hapalogenys kishinouyei complex”. The width of all the three longitudinal stripes below the base of fifth and sixth dorsal fin spines is clearly wider than pupil diameter in H. bengalensis , whereas it is clearly narrower in H. dampieriensis and H. filamentosus at all sizes. Gill raker are 7+ 11in all 14 specimens of Hapalogenys bengalensis , which differs from H. dampieriensis (5–6+11–12) and H. filamentosus (5+11–12). The Pelvic fin tip is extremely filamentous, like H. filamentosus further differentiating the H. bengalensis from the H. kishinouyei and H. dampieriensis . Posterior angle of jaw reaches a vertical through the anteriormost part of the eye in H. bengalensis , whereas in H. filamentosus it reaches the center of the eye. Detailed comparative measurements, counts and proportional measurements of H. bengalensis with other three species of the “ Hapalogenys kishinouyei complex” are given in Table 1 .

The occurrence of Hapalogenys bengalensis new species, from Indian coast in the northern Bay of Bengal is the first record of the family in Indian waters. Hapalogenys merguiensis Iwatsuki, Satapoomin and Amaoka, 2000 was the only species previously known from Myanmar coast of the Andaman Sea, while Hapalogenys kishinouyei Smith and Pope, 1906 occurs on the East Asian Shelf along north-western Australia. The H. bengalensis sp. nov. differs from H. merguiensis Satapoomin and Amaoka, 2000 with having three longitudinal parallel stripes and extremely filamentous Pelvic fin tip. The other five species of the family all have western Pacific distributions.

DNA barcoding data. Genetic divergence and analysis of NJ tree shows that the new species is closely related to H. kishinouyei in the “ Hapalogenys kishinouyei complex”. Sequence based comparison of the new species with H. filamentosus and H. dampieriensis is not possible at present as sequences of the later two species are not available. However, these two species are substantially separated from the new species based on morphological characters.

Figures

FIGURE 1. Hapalogenys bengalensis sp. nov., MARC / ZSI / F 3039 (87 mm SL), Digha Mohana, West Bengal, India.

FIGURE 2. Hapalogenys bengalensis showing chin pores and small papillae, and scaly postero-ventral part of lower (dashed arrows).

FIGURE 3. Posterior angle of jaw reaching vertical through anterior margin of pupil.

FIGURE 4. First ventral soft rays filamentous and reaching beyond the base of first anal-fin spine.

FIGURE 5. PAUP generated NJ tree of Hapalogenys bengalensis relationship with other species inferred from the COI sequences, Pomadasys corvinaeformis (family Haemulidae) has been used as outgroup.

Tables

TABLE 1. Counts and proportional measurements along with characters as percentage of SL of Hapalogenys bengalensis sp. nov., Hapalogenys dampieriensis (Iwatsuki and Russell, 2006), Hapalogenys filamentosus. (Iwatsuki and Russell, 2006) and Hapalogenys kishinouyei (Smith & Pope 1906).

Hapalogenys dampieriensis Holo- Paratypes type n = 8	Hapalogenys filamentosus Holo- Paratypes type n = 3	Hapalogenys kishinouyei Holo- Paratypes type n = 39	Hapalogenys bengalensis sp. nov. Holo- Paratypes type n = 13
Standard length (SL) 224 66-290 Dorsal-fin rays XI, 14 XI, 13–14	147 129-147 XI, 14 XI, 14	81 45-393 XI, 14 XI, 14–15	87.4 45.6-82.3 XI,14 XI,14
Anal-fin rays III, 9 III, 8–9 Pectoral-fin rays 18 17–18 Pored LL scales 44 41–45	III, 9 III, 9 18 17–18 41 41–42	III, 9 III, 9 17 17–18 45 44–47	III, 9 III,9 17 17–19 43 42–45
Scales above and below 12/20 10–12/20– lateral line 23	11/22 10–11/20– 22	11/23 11–13/23– 25	7/19 7–8/19–20
Gill rakers 6+12 5–6+11–12 As percentage of SL Head length 38 34–46	5+11 5+11–12 43 42–43	7+11 4–7+11–13 40 36–42	7+11 7+11 42.7 36.6–43.4
Body depth 45 42–55 Body width 20 18–23 Eye diameter 8 8–16	147 115–149 44 42–44 11 10–11	50 44–53 15 17–21 15 8–17	52.7 43.4–53.0 15.4 13.7–17.98 11.4 10.40–12.8
Snout length 13 14–16 Interorbital space 9 8 Upper jaw length 15 15–16	19 16–20 8 7–8 10 8–10	12 12–17 7 8–10 15 14–16	9.7 7.1–11.8 9.5 7.9–10.2 14.5 13.6–15.2
Suborbital depth 8 5–8 Body depth at anal–fin origin 40 35–47 Caudal peduncle depth 12 11–13	14 14 50 48–50 16 15–16	6 5–8 44 38–46 13 11–13	8.4 5.3–8.0 45.8 38.7–46.1 15.3 12.2–15.3
Caudal peduncle length - 12–17 Predorsal length 39 38–49 Pre-anal length 70 71–77	13 12–13 17 17–18 49 45–49	17 16–18 46 40–49 67 67–74	12.4 11.9–18.6 46.0 38.2–50.1 73.4 65.1–74.2
Prepelvic length 46 40–52 Dorsal fin base 56 54–59 Anal fin base 17 13–17	69 69–74 41 41–48 61 57–61	42 39–48 60 55–62 18 15–20	40.2 40.2–45.3 59.0 55.2–66.9 19.2 15.9–20.8

TABLE 3. Character-based DNA barcodes. Character states (nucleotides) at 23 selected positions of the Cytochrome c oxidase I (CO 1) gene region (ranging from position 35 – 572); numbers of individuals analysed per species are given in brackets; When two character states were present at a given position the number of individuals showing each character is given in brackets.

Hapalogenys kishinouyei A C (n = 4) (3+?)	C	T	C	T	A	A	T	A(2) C G(2)	T
Hapalogenys nigripinnis A C (n = 7)	C	T	C	T	A	A	T	A A	T
Hapalogenys bengalensis sp. G T nov. (n = 3)	T	C	T	C	G	C	C	C G	C
TABLE 3. (Continued)