Cordyligaster fuscipennis (Macquart, 1851)

Fleming, AJ, Wood, D Monty, Smith, M Alex, Janzen, Daniel & Hallwachs, Winnie, 2014, A new species of Cordyligaster Macquart, reared from caterpillars in Area de Conservacion Guanacaste, northwestern Costa Rica, Biodiversity Data Journal 2, pp. 4174-4174 : 4174

publication ID

https://dx.doi.org/10.3897/BDJ.2.e4174

persistent identifier

https://treatment.plazi.org/id/B479FDAC-CB5B-737A-A635-B9D2696AC72E

treatment provided by

Biodiversity Data Journal by Pensoft

scientific name

Cordyligaster fuscipennis (Macquart, 1851)
status

 

Cordyligaster fuscipennis (Macquart, 1851)

Materials

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0006720 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: DHJPAR0006720; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: ASTA898-06,06-SRNP-40070; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Juntas; verbatimElevation: 400; verbatimLatitude: 10.907; verbatimLongitude: -85.288; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.907; decimalLongitude: -85.288; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 01-Feb-2006; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0006723 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: DHJPAR0006723; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: ASTA901-06,05-SRNP-43874; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimLocality: Rio Francia Arriba; verbatimElevation: 400; verbatimLatitude: 10.897; verbatimLongitude: -85.29; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.897; decimalLongitude: -85.29; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 18-Jan-2006; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0006724 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: DHJPAR0006724; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: ASTA902-06,05-SRNP-43875; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimLocality: Rio Francia Arriba; verbatimElevation: 400; verbatimLatitude: 10.897; verbatimLongitude: -85.29; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.897; decimalLongitude: -85.29; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 21-Jan-2006; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0006935 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: DHJPAR0006935; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: ASTAV177-06,06-SRNP-40889; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Juntas; verbatimElevation: 400; verbatimLatitude: 10.907; verbatimLongitude: -85.288; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.907; decimalLongitude: -85.288; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 29-Mar-2006; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0006936 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: DHJPAR0006936; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: ASTAV178-06,06-SRNP-40664; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Juntas; verbatimElevation: 400; verbatimLatitude: 10.907; verbatimLongitude: -85.288; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.907; decimalLongitude: -85.288; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 13-Mar-2006; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0006937 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: DHJPAR0006937; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: ASTAV179-06,06-SRNP-40669; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Juntas; verbatimElevation: 400; verbatimLatitude: 10.907; verbatimLongitude: -85.288; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.907; decimalLongitude: -85.288; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 17-Mar-2006; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0010199 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: DHJPAR0010199; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: ASTAV725-06,06-SRNP-41615; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimLocality: Rio Francia Arriba; verbatimElevation: 400; verbatimLatitude: 10.897; verbatimLongitude: -85.29; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.897; decimalLongitude: -85.29; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 23-May-2006; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0010200 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: DHJPAR0010200; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: ASTAV726-06,06-SRNP-41577; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimLocality: Rio Francia Arriba; verbatimElevation: 400; verbatimLatitude: 10.897; verbatimLongitude: -85.29; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.897; decimalLongitude: -85.29; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 22-May-2006; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0010201 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: DHJPAR0010201; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: ASTAV727-06,06-SRNP-41595; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimLocality: Rio Francia Arriba; verbatimElevation: 400; verbatimLatitude: 10.897; verbatimLongitude: -85.29; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.897; decimalLongitude: -85.29; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 23-May-2006; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0010202 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: DHJPAR0010202; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: ASTAV728-06,06-SRNP-41589; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimLocality: Rio Francia Arriba; verbatimElevation: 400; verbatimLatitude: 10.897; verbatimLongitude: -85.29; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.897; decimalLongitude: -85.29; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 21-May-2006; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0010205 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: DHJPAR0010205; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: ASTAV731-06,06-SRNP-41628; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimLocality: Rio Francia Arriba; verbatimElevation: 400; verbatimLatitude: 10.897; verbatimLongitude: -85.29; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.897; decimalLongitude: -85.29; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 24-May-2006; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0010206 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: DHJPAR0010206; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: ASTAV732-06,06-SRNP-41578; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimLocality: Rio Francia Arriba; verbatimElevation: 400; verbatimLatitude: 10.897; verbatimLongitude: -85.29; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.897; decimalLongitude: -85.29; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 25-May-2006; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0010207 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: DHJPAR0010207; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: ASTAV733-06,06-SRNP-41600; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimLocality: Rio Francia Arriba; verbatimElevation: 400; verbatimLatitude: 10.897; verbatimLongitude: -85.29; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.897; decimalLongitude: -85.29; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 24-May-2006; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0010208 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: DHJPAR0010208; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: ASTAV734-06,06-SRNP-41613; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimLocality: Rio Francia Arriba; verbatimElevation: 400; verbatimLatitude: 10.897; verbatimLongitude: -85.29; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.897; decimalLongitude: -85.29; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 24-May-2006; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0010209 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: DHJPAR0010209; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: ASTAV735-06,06-SRNP-41579; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimLocality: Rio Francia Arriba; verbatimElevation: 400; verbatimLatitude: 10.897; verbatimLongitude: -85.29; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.897; decimalLongitude: -85.29; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 24-May-2006; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0010210 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: DHJPAR0010210; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: ASTAV736-06,06-SRNP-41616; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimLocality: Rio Francia Arriba; verbatimElevation: 400; verbatimLatitude: 10.897; verbatimLongitude: -85.29; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.897; decimalLongitude: -85.29; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 24-May-2006; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0010212 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: DHJPAR0010212; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: ASTAV738-06,06-SRNP-41582; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimLocality: Rio Francia Arriba; verbatimElevation: 400; verbatimLatitude: 10.897; verbatimLongitude: -85.29; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.897; decimalLongitude: -85.29; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 27-May-2006; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0010213 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: DHJPAR0010213; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: ASTAV739-06,06-SRNP-41586; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimLocality: Rio Francia Arriba; verbatimElevation: 400; verbatimLatitude: 10.897; verbatimLongitude: -85.29; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.897; decimalLongitude: -85.29; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 26-May-2006; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0019634 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: DHJPAR0019634; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: ASTAB182-07,07-SRNP-40768; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Juntas; verbatimElevation: 400; verbatimLatitude: 10.907; verbatimLongitude: -85.288; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.907; decimalLongitude: -85.288; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 11-Apr-2007; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0030036 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: DHJPAR0030036; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: ASHYB780-09,09-SRNP-243; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector San Cristobal; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Huerta; verbatimElevation: 527; verbatimLatitude: 10.931; verbatimLongitude: -85.372; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.931; decimalLongitude: -85.372; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 12-Feb-2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0030037 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: DHJPAR0030037; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: ASHYB781-09,09-SRNP-246; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector San Cristobal; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Huerta; verbatimElevation: 527; verbatimLatitude: 10.931; verbatimLongitude: -85.372; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.931; decimalLongitude: -85.372; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 14-Feb-2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0030038 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: DHJPAR0030038; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: ASHYB782-09,09-SRNP-250; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector San Cristobal; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Huerta; verbatimElevation: 527; verbatimLatitude: 10.931; verbatimLongitude: -85.372; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.931; decimalLongitude: -85.372; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 16-Feb-2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0030039 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: DHJPAR0030039; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: ASHYB783-09,09-SRNP-254; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector San Cristobal; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Huerta; verbatimElevation: 527; verbatimLatitude: 10.931; verbatimLongitude: -85.372; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.931; decimalLongitude: -85.372; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 06-Feb-2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0030462 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: DHJPAR0030462; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: ASHYB1205-09,09-SRNP-242; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector San Cristobal; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Huerta; verbatimElevation: 527; verbatimLatitude: 10.931; verbatimLongitude: -85.372; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.931; decimalLongitude: -85.372; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 12-Feb-2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0030463 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: DHJPAR0030463; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: ASHYB1206-09,09-SRNP-256; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector San Cristobal; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Huerta; verbatimElevation: 527; verbatimLatitude: 10.931; verbatimLongitude: -85.372; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.931; decimalLongitude: -85.372; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 04-Feb-2009; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0037670 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: DHJPAR0037670; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: ASHYC4415-10,10-SRNP-40318; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Juntas; verbatimElevation: 400; verbatimLatitude: 10.907; verbatimLongitude: -85.288; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.907; decimalLongitude: -85.288; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 12-Feb-2010; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0038713 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: DHJPAR0038713; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: ASHYD2286-10,09-SRNP-68574; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimLocality: Melas; verbatimElevation: 153; verbatimLatitude: 10.958; verbatimLongitude: -85.284; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.958; decimalLongitude: -85.284; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 14-Jan-2010; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: 98-SRNP-7747 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: 98-SRNP-7747; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 98-SRNP-7747; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector San Cristobal; locality: Area de Conservacion Guanacaste ; verbatimLocality: Estacion San Cristobal; verbatimElevation: 640; verbatimLatitude: 10.87097; verbatimLongitude: -85.39144; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.87097; decimalLongitude: -85.39144; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 22/Sep/98; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: 98-SRNP-7766 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: 98-SRNP-7766; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 98-SRNP-7766; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector San Cristobal; locality: Area de Conservacion Guanacaste ; verbatimLocality: Estacion San Cristobal; verbatimElevation: 640; verbatimLatitude: 10.87097; verbatimLongitude: -85.39144; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.87097; decimalLongitude: -85.39144; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: Sep-22-1998; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: 99-SRNP-13079 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: 99-SRNP-13079; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 99-SRNP-13079; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector San Cristobal; locality: Area de Conservacion Guanacaste ; verbatimLocality: Cementerio Viejo; verbatimElevation: 570; verbatimLatitude: 10.88111; verbatimLongitude: -85.38889; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.88111; decimalLongitude: -85.38889; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: Sep-25-1999; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: 99-SRNP-13070 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: 99-SRNP-13070; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 99-SRNP-13070; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector San Cristobal; locality: Area de Conservacion Guanacaste ; verbatimLocality: Cementerio Viejo; verbatimElevation: 570; verbatimLatitude: 10.88111; verbatimLongitude: -85.38889; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.88111; decimalLongitude: -85.38889; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: Sep-25-1999; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: 99-SRNP-12940 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: 99-SRNP-12940; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 99-SRNP-12940; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector San Cristobal; locality: Area de Conservacion Guanacaste ; verbatimLocality: Cementerio Viejo; verbatimElevation: 570; verbatimLatitude: 10.88111; verbatimLongitude: -85.38889; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.88111; decimalLongitude: -85.38889; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: Sep-17-1999; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: 99-SRNP-12921 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: 99-SRNP-12921; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 99-SRNP-12921; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector San Cristobal; locality: Area de Conservacion Guanacaste ; verbatimLocality: Cementerio Viejo; verbatimElevation: 570; verbatimLatitude: 10.88111; verbatimLongitude: -85.38889; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.88111; decimalLongitude: -85.38889; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: Sep-17-1999; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: 99-SRNP-12923 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: 99-SRNP-12923; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 99-SRNP-12923; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector San Cristobal; locality: Area de Conservacion Guanacaste ; verbatimLocality: Cementerio Viejo; verbatimElevation: 570; verbatimLatitude: 10.88111; verbatimLongitude: -85.38889; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.88111; decimalLongitude: -85.38889; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: Sep-17-1999; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: 99-SRNP-12945 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: 99-SRNP-12945; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 99-SRNP-12945; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector San Cristobal; locality: Area de Conservacion Guanacaste ; verbatimLocality: Cementerio Viejo; verbatimElevation: 570; verbatimLatitude: 10.88111; verbatimLongitude: -85.38889; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.88111; decimalLongitude: -85.38889; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: Sep-17-1999; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: 99-SRNP-13077 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: 99-SRNP-13077; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 99-SRNP-13077; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector San Cristobal; locality: Area de Conservacion Guanacaste ; verbatimLocality: Cementerio Viejo; verbatimElevation: 570; verbatimLatitude: 10.88111; verbatimLongitude: -85.38889; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.88111; decimalLongitude: -85.38889; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: Sep-25-1999; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: 99-SRNP-12895 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: 99-SRNP-12895; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 99-SRNP-12895; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector San Cristobal; locality: Area de Conservacion Guanacaste ; verbatimLocality: Cementerio Viejo; verbatimElevation: 570; verbatimLatitude: 10.88111; verbatimLongitude: -85.38889; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.88111; decimalLongitude: -85.38889; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: Sep-17-1999; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: 99-SRNP-13071 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: 99-SRNP-13071; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 99-SRNP-13071; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector San Cristobal; locality: Area de Conservacion Guanacaste ; verbatimLocality: Cementerio Viejo; verbatimElevation: 570; verbatimLatitude: 10.88111; verbatimLongitude: -85.38889; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.88111; decimalLongitude: -85.38889; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: Sep-25-1999; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: 01-SRNP-4155 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: 01-SRNP-4155; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 01-SRNP-4155; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimLocality: Camino Rio Francia; verbatimElevation: 410; verbatimLatitude: 10.90425; verbatimLongitude: -85.28651; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.90425; decimalLongitude: -85.28651; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: Jan-27-2001; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: 01-SRNP-4156 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: 01-SRNP-4156; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 01-SRNP-4156; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimLocality: Camino Rio Francia; verbatimElevation: 410; verbatimLatitude: 10.90425; verbatimLongitude: -85.28651; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.90425; decimalLongitude: -85.28651; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: Jan-27-2001; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: 04-SRNP-42944 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: 04-SRNP-42944; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 04-SRNP-42944; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Parcelas; verbatimElevation: 375; verbatimLatitude: 10.90777; verbatimLongitude: -85.29137; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.90777; decimalLongitude: -85.29137; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: Dec-13-2004; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Type status: Other material. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: 04-SRNP-42943 ; recordedBy: D.H. Janzen & W. Hallwachs; individualID: 04-SRNP-42943; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 04-SRNP-42943; Taxon: scientificName: Cordyligaster petiolata; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: fuscipennis; scientificNameAuthorship: (Macquart, 1851); Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimLocality: Sendero Parcelas; verbatimElevation: 375; verbatimLatitude: 10.90777; verbatimLongitude: -85.29137; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.90777; decimalLongitude: -85.29137; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: Dec-13-2004; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen GoogleMaps

Description

Male (Fig. 5); Head: fronto orbital plate with silver tomentosity except at apex near ocellar triangle where silver gives way to black; antenna black with plumose arista; eye bare; ocellar bristles parallel and proclinate approximately twice the length of the ocellar triangle; fronto-orbital plate narrowing at apex enclosing only the ocellar triangle; proclinate orbital bristles absent in males; palpus black. Thorax: dorsal surface glabrous black, very slightly tomentose when viewd laterally. 3 post-sutural supra alar bristles, (one strong anterior, second and third bristles weak; first bristle strongest, almost 2X thickness of other post sutural supra alars); apical scutellar bristles long, equal in length of subapical scutellars; subapical scutellar bristles parallel or divergent (forming a wide V); katepisternum bearing 2 bristles, lateral view of thorax bearing 3 tomentose bands apparent (apparent when viewed from the side). Wings: dark smoky black in colour, clear to slightly smoky white towards wing base; vein R1 haired (Fig. 4a). Legs; black. Abdomen: all black, petiolate with both discal bristles and median marginal bristles present on T1+2, T3, T4 and T5. Silver pollinosity on upper margins of abdominal segments T3, and T4. Tomentosity covering T5 but as in the case of the thorax, this is only visible when viewed in certain angles of light, in this case dorsally.

Female (Fig. 6); Head: fronto orbital plate with silver tomentosity; parafacial silver; antenna black with plumose arista; eye bare; ocellar bristles parallel and proclinate approximately twice the length of the ocellar triangle; fronto-orbital plate slightly narrowing at apex to almost the width of the ocellar triangle; frontal vitta 2 times as wide as face; proclinate orbital bristles present; palpus black. Thorax: at first glance appears glabrous black, however under certain angles of light a very light tomentum becomes apparent. Three post-sutural supra alar bristles, (two strong anterior, and third one weak; second bristle strongest, 1.5X thickness of first pssa; apical scutellar bristles long, equal in length of subapical scutellars; scutellar bristles divergent (forming a wide V); katepisternum bearing 2 bristles, tomentose bands as in male, these bands apparent when viewed laterally. Wings: smoky black in colour, dark amber towards wing base; vein R1 haired, vein R3 haired along ½ of its length. Legs: black. Abdomen: all black, petiolate petiolate with both discal bristles and median marginal bristles present on T1+2, T3, T4 and T5. Silver pollinosity on upper margins of abdominal segments T3, and T4. Very light tomentosity present on T5 but as in the case of the thorax, this is only visible under certain angles of light.

Diagnosis

This species is easily recognized by its relatively large size, black palpus, black antenna, and all black abdomen. It is distinguished from C. petiolata ( Wiedemann 1830), by the lack of yellow spots on T3 ( Sabrosky 1973). Species has the DNA barcode recorded below:

AACTTTATACTTTATTTTCGGTGCTTGATCAGGAATACTAGGAACATCTTTAAGAATTTTAATTCGAACAGAATTAGGACATCCAGGTTCACTAATTGGAGATGATCAAATTTATAACGTAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGACTACTTCCCCCTTCTTTATTACTTCTCCTAATTGGTAGAATAGTTGAAAATGGAGCTGGAACAGGATGAACAGTTTACCCTCCTTTATCTTCTAATATTGCACATAGAGGATCTTCTGTTGACTTAACTATTTTTTCACTACATTTAGCAGGTATTTCTTCTATTATAGGAGCTGTAAATTTTATTACAACAGTAATTAATATACGATCAACAGGAATTACATTTGATCGAATACCTTTATTTGTTTGATCTGTAGCAATTACAGCATTATTATTACTTTTATCTTTACCTGTATTAGCAGGAGCTATTACCATATTATTAACTGATCGAAATATAAATACTTCTTTTTTTGACCCAGCAGGAGGAGGAGANCCTATTTTATACCAACATTTATTT

Genetic comparison to the type specimens of previously know species was outside the scope of this paper, however the authors have selected to give the barcode data here as a diagnostic character such that it is readily available for future works which may undertake the barcoding of those previously described types.

Distribution

Costa Rica, ACG, Prov. Guanacaste, rain forest, 153 - 640m elevation. Originally described from "South America", this species has been found to be very widely distributed, from Brazil, west to Bolivia and Peru, and North to Guatemala.

Ecology

Hosts: Three species of leaf-rolling spilomeline Crambidae feeding on leaves of rain forest Urticaceae .

Kingdom

Animalia

Phylum

Arthropoda

Class

Insecta

Order

Diptera

Family

Tachinidae

Genus

Cordyligaster