Damas cervelina (Orellana & Costa, 2019)

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Orellana, Andrés, Brockmann, Ernst, Mielke, Carlos G. C., Mielke, Olaf H. H., Costa, Mauro & Grishin, Nick V., 2023, Lessons from the genomic analysis of Hesperiidae (Lepidoptera) holotypes in the MIZA collection (Maracay, Venezuela), Zootaxa 5319 (4), pp. 573-581 : 579

Damas cervelina (Orellana & Costa, 2019) , comb. nov.

As the genomic trees reveal ( Fig. 3 ), originally proposed in the genus Megaleas Godman, 1901 , M. cervelina Orellana & Costa, 2019 (type locality in Venezuela, holotype in MIZA), is not closely related to the type species Megaleas syrna (Godman & Salvin, 1879) (type locality in Costa Rica), in the subtribe Hesperiina , and instead originates within the genus Damas (type species Goniloba clavus Herrich-Schäffer, 1869 ) in the subtribe Carystina Mabille 1878 . Therefore, we transfer M. cervelina to this genus forming Damas cervelina (Orellana & Costa, 2019), comb. nov. Curiously, Calpodes chocoensis (Salazar & Constantino, 2013) (type locality in Colombia: Valle del Cauca), which was also originally proposed in Megaleas , did not belong there either ( Zhang et al. 2022b). Therefore, the similarity in wing patterns due to large and blotchy orange spots on forewings does not signify evolutionary relationship and is convergent. The COI barcode sequence of the holotype of D. cervelina , sample NVG-19047D12, GenBank accession OR178496, 658 base pairs is:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGATTATTAGGAACTTCTTTAAGTATATTAATTCGAACAGAATTAGGAAATCCTGGATCTTTAATTGGA GATGATCAAATTTATAATACAATTGTTACAGCTCATGCCTTTATTATAATTTTTTTTATAGTCATACCTATTATAATTGGAGGATTTGGTAATTGATTAG TACCATTAATATTAGGTGCTCCTGATATAGCCTTTCCTCGAATAAACAATATAAGATTTTGAATGTTACCCCCATCATTAATCTTATTAATTTCAAGAAG AATCGTAGAAACTGGAGCAGGAACTGGCTGAACTGTTTACCCCCCTCTTTCCTCCAATATTGCTCACCAAGGAGCTTCAGTAGATTTAGCTATTTTTTCT TTACATTTAGCTGGAATTTCCTCCATTTTAGGAGCAATTAATTTTATTACCACAATTATCAATATACGTGTAAGAAACTTATCCTTTGATCAAATACCCT TATTTGTATGATCAGTAGGAATTACAGCCCTCTTATTACTTTTATCTTTACCAGTTTTAGCAGGGGCTATTACTATATTACTTACTGATCGAAACCTTAA TACTTCTTTTTTTGACCCAGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Figures

FIGURE 3.Phylogenetic placement of Damas cervelina inthe treesconstructed from protein-coding regionsina)Z chromosome and b) mitochondrial genome: Carystina (blue) with D. cervelina (magenta, highlighted in yellow), and Hesperiina (green) with Megaleas syrna (purple). The clade of Damas is labeled. See Fig. 1 legend for other notations.