Jemadia demarmelsi Orellana, [2010]

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Orellana, Andrés, Brockmann, Ernst, Mielke, Carlos G. C., Mielke, Olaf H. H., Costa, Mauro & Grishin, Nick V., 2023, Lessons from the genomic analysis of Hesperiidae (Lepidoptera) holotypes in the MIZA collection (Maracay, Venezuela), Zootaxa 5319 (4), pp. 573-581 : 577

Jemadia demarmelsi Orellana, [2010] confirmed as a species-level taxon

Genomic sequencing of the holotype of Jemadia demarmelsi Orellana, [2010] (type locality in Venezuela: Bolívar) in the MIZA collection reveals that in genomic trees it is placed in its own clade of similar prominence to J. pseudognetus and J. hospita ( Fig. 1 ), and its COI barcode differs by 4.3% (28 bp) and 3.0% (20 bp) from these species, respectively. Therefore, we confirm the close relationship of J. demarmelsi with these two species and its distinctness from them at the species level. Moreover, sequencing of a female specimen from Bolívar, Venezuela (NVG-20054H05, Fig. 2 ) with very large forewing hyaline spots that are similar to J. demarmelsi holotype establishes it as a female of J. demarmelsi due to genetic similarities ( Fig. 1 , COI barcodes 100% identical). Interestingly, the coloration of the bands in the female is cyan-blue, not purplish, as in the male holotype. The COI barcode sequence of the holotype of J. demarmelsi , sample NVG-22029C06, GenBank accession OR178493, 658 base pairs is:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGAACATCTTTAAGATTATTAATTCGAACTGAGCTAGGAATTCCAGGATCTTTAATCGGA GATGATCAAATCTATAATACTATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAG TACCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGATTACTACCCCCTTCTTTGACCCTGCTTATTTCAAGCAG TATTGTAGAAAATGGTGCTGGTACTGGTTGAACTGTTTATCCCCCTCTTTCTTCTAATATTGCCCACCAAGGAGCCTCTGTAGATATAGCTATTTTTTCT TTACATTTAGCAGGAATTTCCTCAATTTTAGGAGCTATCAACTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCTTTTGATCAAATACCAT TATTTGTTTGAGCAGTTGGAATTACAGCATTACTTTTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTACTAACAGATCGAAATATTAA TACCTCTTTCTTTGACCCTGCTGGAGGTGGGGATCCTATTTTATATCAACATTTATTT

Figures

FIGURE 1. Phylogenetic trees of selected Pyrrhopyginae species constructed from protein-coding regions in a) Z chromosome and b) mitochondrial genome: Amenis pionia (gray), Amenis pedro stat. nov. (dark blue), Amenis picia (maroon), Amenis ponina (green), Jemadia pseudognetus (blue), Jemadia hospita (purple), Jemadia demarmelsi (orange), Jemasonia pater (cyan), Jemasonia albescens (red), Jemasonia hewitsonii (oilve), and Jemasonia sosia stat. rest. (aquamarine) The holotypes of species proposed by Orellana ([2010]) are labeled in magenta and highlighted in yellow. Statistical support values are shown at nodes. For each specimen, the name adopted in this work is given first, with comments or previously used name listed in square brackets (if different), supplemented with the DNA sample number, type status (see Materials and Methods for abbreviations) general locality and year it was collected (old means around and prior to the beginning of the 20th century, exact year not specified). See NCBI database entries in the bioproject PRJNA986225 for additional data about these specimens. Synonyms are given in parentheses preceded by “=”. The type status refers to this synonym, if the synonym name is provided.

FIGURE 2. A female of Jemadia demarmelsi NVG-20054H05 from Venezuela, Bolívar, Gran Sabana, Kavanayén, 1350 m, 05-Mar-2017, M. Costa leg.