Amenis ponina rogeri Orellana, [2010]

Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Orellana, Andrés, Brockmann, Ernst, Mielke, Carlos G. C., Mielke, Olaf H. H., Costa, Mauro & Grishin, Nick V., 2023, Lessons from the genomic analysis of Hesperiidae (Lepidoptera) holotypes in the MIZA collection (Maracay, Venezuela), Zootaxa 5319 (4), pp. 573-581 : 575-577

Amenis ponina rogeri Orellana, [2010] , stat. nov.

The original description of Amenis rogeri Orellana, [2010] discussed and illustrated the similarity of its genitalia with Amenis ponina (Herrich-Schäffer, 1869) , suggesting that there are no diagnostic differences in their genitalia: “y dado la variabilidad individual observada en ambas especies, podemos afirmar que tales estructuras son iguales.” ( Orellana [2010]). Equally, we found strong genetic similarities between A. rogeri and A. ponina : the holotype of A. rogeri (in MIZA) is sister to the two specimens of A. ponina and is closer to them that any other pair of species in the trees ( Fig. 1 ). Their COI barcodes differ by only 0.5% (3 bp). The major difference between A. rogeri and A. ponina is in their wing patterns: A. rogeri is unexpectedly more similar to A. pionia (e.g., both have whitish fringes) than to A. ponina (distinctly orange fringes), as detailed in the original description ( Orellana [2010]). Therefore, due to the lack of genitalic and genetic differences at the level characteristic for species-level, we propose to treat A. rogeri as a subspecies: Amenis ponina rogeri Orellana, [2010] , stat. nov. However, we sequenced only one A. p. rogeri specimen (the holotype), and we have not yet studied Amenis pionia sandra Orellana, [2010] . Hence, additional work on these taxa may bring further insights. The COI barcode sequence of the holotype of A. p. rogeri , sample NVG-22029C08, GenBank accession OR178491, 658 base pairs is:

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGAACATCTTTAAGACTATTAATCCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGA GACGATCAAATTTATAATACTATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAG TCCCTCTTATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCCCCTTCATTAATTCTACTTATTTCTAGCAG TATTGTAGAAAATGGTGCTGGAACTGGATGAACTGTTTACCCTCCTCTTTCTTCTAATATTGCTCATCAAGGAGCTTCTGTAGATTTAGCTATTTTTTCC CTACATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATCATTAATATACGAATTAAAAATTTATCTTTTGACCAAATACCTT TATTTGTATGAGCTGTTGGTATTACAGCATTATTATTACTTTTATCTTTACCTGTTTTAGCAGGAGCTATTACAATATTATTAACAGACCGAAATATTAA TACTTCTTTTTTTGATCCTGCAGGAGGAGGAGATCCTATTTTATACCAACATCTATTT

Figures

FIGURE 1. Phylogenetic trees of selected Pyrrhopyginae species constructed from protein-coding regions in a) Z chromosome and b) mitochondrial genome: Amenis pionia (gray), Amenis pedro stat. nov. (dark blue), Amenis picia (maroon), Amenis ponina (green), Jemadia pseudognetus (blue), Jemadia hospita (purple), Jemadia demarmelsi (orange), Jemasonia pater (cyan), Jemasonia albescens (red), Jemasonia hewitsonii (oilve), and Jemasonia sosia stat. rest. (aquamarine) The holotypes of species proposed by Orellana ([2010]) are labeled in magenta and highlighted in yellow. Statistical support values are shown at nodes. For each specimen, the name adopted in this work is given first, with comments or previously used name listed in square brackets (if different), supplemented with the DNA sample number, type status (see Materials and Methods for abbreviations) general locality and year it was collected (old means around and prior to the beginning of the 20th century, exact year not specified). See NCBI database entries in the bioproject PRJNA986225 for additional data about these specimens. Synonyms are given in parentheses preceded by “=”. The type status refers to this synonym, if the synonym name is provided.