Clubiona jiugong Yu & Zhong, 2021
publication ID |
https://dx.doi.org/10.3897/BDJ.9.e66260 |
publication LSID |
lsid:zoobank.org:pub:BBE1D9DC-A0B0-436E-A2EC-D82422C45169 |
persistent identifier |
https://treatment.plazi.org/id/36F4D405-32D2-4119-97B6-9C3758C20F22 |
taxon LSID |
lsid:zoobank.org:act:36F4D405-32D2-4119-97B6-9C3758C20F22 |
treatment provided by |
Biodiversity Data Journal by Pensoft (2021-04-29 13:38:37, last updated 2022-11-11 00:20:58) |
scientific name |
Clubiona jiugong Yu & Zhong |
status |
sp. n. |
Clubiona jiugong Yu & Zhong sp. n.
Materials
Type status: Holotype. Occurrence: recordedBy: Qianle Lu; individualID: YHCLU0274; individualCount: 1; sex: male; lifeStage: adult; behavior: foraging; preparations: whole animal (EtOH); associatedSequences: GenBank: MZ020606 View Materials ; Taxon: order: Araneae; family: Clubionidae; genus: Clubiona; specificEpithet: jiugong; scientificNameAuthorship: Yu & Zhong; Location: continent: Asian; country: China; countryCode: CHN; stateProvince: Hubei; county: Tongshan; locality: Jiugongshan Nature Reserve ; decimalLatitude: 29.39; decimalLongitude: 114.65; Identification: identifiedBy: Hao Yu; dateIdentified: 2020-07; Event: samplingProtocol: by hand; samplingEffort: 10 km by foot; year: 2020; month: 7; day: 3; Record Level: institutionCode: MGEU; basisOfRecord: Preserved Specimen Type status: Holotype. Occurrence: recordedBy: Qianle Lu; individualID: YHCLU0275; individualCount: 1; sex: female; lifeStage: adult; behavior: foraging; preparations: whole animal (EtOH); associatedSequences: GenBank: MZ020605 View Materials ; Taxon: order: Araneae; family: Clubionidae; genus: Clubiona; specificEpithet: jiugong; scientificNameAuthorship: Yu & Zhong; Location: continent: Asian; country: China; countryCode: CHN; stateProvince: Hubei; county: Tongshan; locality: Jiugongshan Nature Reserve ; decimalLatitude: 29.39; decimalLongitude: 114.65; Identification: identifiedBy: Hao Yu; dateIdentified: 2020-07; Event: samplingProtocol: by hand; samplingEffort: 10 km by foot; year: 2020; month: 7; day: 4; Record Level: institutionCode: MGEU; basisOfRecord: Preserved Specimen GoogleMaps GoogleMaps GoogleMaps GoogleMaps
Description
Male (Fig. 3 View Figure 3 E and F). Dimensions in mm. Total length 2.60; carapace 1.33 long, 1.02 wide; abdomen 1.27 long, 0.75 wide.
Colour of the living holotype male was dark brown with red brown abdomen (Fig. 1 View Figure 1 B). Carapace yellowish-brown in ethanol (Fig. 3 View Figure 3 E and F), without a distinct pattern. Fovea red. In dorsal view, anterior eye row (AER) slightly recurved, posterior eye row (PER) almost straight, PER wider than AER. Eye sizes and interdistances (mm): anterior median eyes (AME) 0.08, anterior lateral eyes (ALE) 0.09, posterior median eyes (PME) 0.08, posterior lateral eyes (PLE) 0.07; distance between AMEs (AME-AME) 0.03, distance between AME and ALE (AME-ALE) 0.04, distance between PMEs (PME-PME) 0.16, distance between PME and PLE (PME-PLE) 0.06. Length of median ocular quadrangle (MOQ) 0.18, MOQ anterior width 0.18, MOQ posterior width 0.29. Chelicerae coloured as carapace, with 5 teeth on promargin and 3 on retromargin. Labium and endites yellowish-brown. Sternum 0.70 long, 0.42 wide.
Abdomen red in ethanol (Fig. 3 View Figure 3 E and F), elongate-oval, dorsum centrally with a lengthwise reticular pattern, reaching 2/5th of abdomen length, posteriorly with a fuzzy pattern represented by numerous horizontal stripes or blotches; ventre reddish-brown; spinnerets light brown.
Legs uniformly yellowish-brown in ethanol (Fig. 3 View Figure 3 E and F). Leg length (mm): I 2.62 (0.80, 1.05, 0.52, 0.25), II 2.84 (0.80, 1.30, 0.49, 0.26), III 2.27 (0.75, 0.78, 0.48, 0.25), IV 3.37 (1.11, 1.27, 0.98, 0.30).
Palp (Fig. 1 View Figure 1 C and Fig. 2 View Figure 2 A-E). Femur and patella unmodified. Tibia short, with single retrolateral apophysis; retrolateral tibial apophysis (RTA) broad, triangular, distally bifurcate in retrolateral view, both tips blunt. Tegulum oval and relativlely flat, ca. twice longer than wide, sperm duct distinct and sinuous; subtegulum (ST) large, located prolaterally. Embolar part (EP) represented by a wide and flat sclerite, situated prolaterally on the tegulum; embolar part apophysis (EPA) strong, slender and long, about as long as tegulum width, shaped like a dagger, originating on the prolateral flank (approximately 11 o’clock on tegulum), transversally curved to the retrolateral side. Embolus (E) inserted at approximately ten o’clock on tegulum, slender and flagelliform, angled across tegular tip, stretched proximally along membranous conductor, tip extending to one-third of tegulum. Conductor (C) area relatively small, approximately two-fifths the length of tegulum.
Female (Fig. 3 View Figure 3 G and H. Dimensions in mm) Total length 3.64; carapace 1.61 long, 1.14 wide; abdomen 2.03 long, 1.35 wide. Eye sizes and interdistances: AME 0.09, ALE 0.19, PME 0.07, PLE 0.07, AME-AME 0.05, AME-ALE 0.04, PME-PME 0.19, PME-PLE 0.09. MOQL 0.25, MOQA 0.23, MOQP 0.36. Sternum 0.87 long, 0.49 wide. Measurements of legs: I 2.65 (0.77, 1.10, 0.53, 0.25), II 2.79 (0.84, 1.15, 0.58, 0.22), III 2.52 (0.66, 0.98, 0.65, 0.23), IV 3.81 (1.25, 1.26, 0.94, 0.35). General characters as in female, but slightly larger in size and lighter in colour.
Epigyne (Fig. 3 View Figure 3 A-D). Epigynal plate distinctly longer than wide, anterior and lateral margin not delimited, posterior margin rebordered, heavily sclerotised and convex; spermathecae (SP) clearly visible through the tegument in ventral view. Two copulatory openings (CO) large, partly fused, situated at medial portion of epigynal plate posterior margin, anteriorly hidden by a hood. Hood (H) wider than 1/2 of epigyne width, heavily sclerotised, V or U-shaped. Hyaline copulatory ducts (CD) thin, ascending in parallel, the proximal half close together, the distal half widely separated and gently curved towards the bursae. Both spermathecae (SP) and bursae (BS) with smooth surfaces, the former anteriad and distinctly larger than the latter. Spermatheca shaped like a chicken egg, inside pigmented and sclerotised, the two spermathecae closely spaced. Bursae globular, separated by ca. 1.2 diameters.
DNA barcode
5'CTTGATCTGCTATAGCAGGAACAGCTATAAGTGTTATAATTCGTATAGAATTAGGACAATCTGGAACATTTTTAGGAGATGATCATTTATATAATGTAGTAGTTACAGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATACCTATTTTAATTGGAGGTTTTGGAAATTGAATAATTCCTATGATATTAGGAGCAGCTGATATAGCTTTTCCTCGTATAAATAATTTAAGTTTTTGATTATTACCTCCTTCGTTATTTATATTATTTATATCTTCTATAGCTGAAATAGGTGTGGGAGCAGGGTGAACTATTTATCCTCCTCTTGCATCTAGTATAGGTCATACAGGAAGAGCTATAGATTTTGCTATTTTTTCGTTACATCTAGCTGGAGCTTCTTCTATTATAGGGGCTGTAAATTTTATTACTACTATTATTAATATACGATATATTGGGATGAGAATAGAAAAAGTTCCATTATTTGTTTGGTCTGTTATAATTACTGCAGTACTCTTATTATTATCATTACCTGTATTAGCAGGTGCTATTACTATATTATTGACTGATCGAAATTTTAATACATCTTTTTTTGATCCAGCTGGAGGGGGAGATCCTATTTTATTTCAGCATTTATTTTGATTTTTTGG3' (holotype, YHCLU0274; GenBank: MZ020606)
DNA barcode
5'TTTGATCTGCTATAGTAGGAACAGCTATAAGTGTTATAATTCGTATAGAATTGGGACAATCTGGAACATTTTTAGGAGATGATCATTTATATAATGTAGTAGTTACAGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATACCAATTTTAATTGGAGGTTTTGGAAATTGAATAATTCCTATGATATTAGGAGCAGCTGATATAGCTTTTCCTCGTATAAATAATTTAAGTTTTTGATTATTACCCCCTTCGTTATTTATATTATTTATATCTTCTATAGCTGAAATAGGTGTGGGAGCAGGGTGAACTATTTATCCTCCTCTTGCATCTAGTATAGGTCATACAGGAAGAGCTATAGATTTTGCTATTTTTTCGTTACATCTAGCTGGAGCTTCTTCTATTATAGGGGCTGTAAATTTTATTACTACTATTATTAATATACGATATATTGGGATGAGAATAGAAAAAGTTCCATTATTTGTTTGGTCTATTATAATTACTGCAGTACTCTTATTATTATCATTACCTGTATTAGCAGGTGCTATTACTATATTATTGACTGATCGAAATTTTAATACATCTTTTTTTGACCCAGCTGGAGGAGGAGATCCTATTTTATTTCAGCATTTATTTTGATTTTTTGG3' (paratype, YHCLU0275; GenBank: MZ020605)
Diagnosis
Clubiona jiugong sp. nov. resembles the other Clubiona zilla -group species by the similar habitus (tiny body with length not exceeding 4 mm), but is consistently separable by its genitalia. Male of the new species resembles that of C. hooda ( Dong and Zhang 2016: 7, figures 5-7 and 10-12) in having a dagger-shaped EPA and a flagelliform embolus, but can be recognised by the RTA distally bifurcate (Fig. 1 View Figure 1 C) (vs. RTA not branched in C. hooda ) and by the EPA originating from the prolateral portion of the tegulum, pointed to the retrolateral side (Fig. 1 View Figure 1 C, Fig. 2 View Figure 2 A and C-E) (vs. EPA originating retrolaterally and curved to the prolateral side). Females of C. jiugong sp. nov. can be easily distinguished from other members of the C. zilla -group, with the exception of C. zilla ( Ono 1986: 119, figures 6-8) by the hood represented by a transverse sclerotised plate (hoods represented by pairs of guide pockets in all other Clubiona zilla -group species) and differ from C. zilla by: (1) copulatory openings closely spaced and partly fused, situated at the medial portion of epigynal plate posterior margin (Fig. 3 View Figure 3 A and B) (vs. copulatory openings well separated by ca. 0.8 diameters, situated basolaterally in C. zilla ); (2) the proximal half of copulatory ducts close together (Fig. 3 View Figure 3 A and B) (vs. the proximal half of copulatory ducts well separated by more than 4 diameters); (3) spermatheca oval and large, its diameter nearly 1/2 of epigynal width (Fig. 3 View Figure 3 C and D) (vs. spermatheca globular and small, its diameter slightly less than 1/5 of epigynal width).
Etymology
The species name is derived from the name of the type locality; noun in apposition.
Distribution
Known from the Mt. Jiugong, Hubei Province, China (Fig. 1 View Figure 1 A).
Biology
The holotype of C. jiugong sp. nov. was obtained from foliage in a bush close to a mountain road in the core zone of Jiugong mountain range.
Dong, X. Y., Zhang, F., 2016. One new species of the Clubiona trivialis -group (Araneae: Clubionidae) from Hebei Province, China. Acta Arachnologica 65 (1): 7 - 10
Ono, H., 1986. Little-known Japanese spider, Clubiona zilla (Araneae, Clubionidae)- representative of a new and peculiar species-group. Bulletin of the National Museum of Nature and Science Tokyo A (12): 117 - 121
Figure 1. Clubiona jiugong sp. nov. A. Distribution record (red circles); B. Male holotype; C. Male left palp of the holotype, ventral view. Abbreviations: C = conductor; E = embolus; EP = embolar part; EPA = embolar part apophysis; RTA = retrolateral tibial apophysis; ST = subtegulum. Scale bar: 0.1 mm (C). The photograph of the living spider was provided by Qianle Lu (Shenzhen, Guangdong).
Figure 2. Male left palp of the holotype of Clubiona jiugong sp. nov. A. Prolateral view; B. Rretrolateral view; C. Bulb, prolateral view; D. Bulb, ventral view; E. Bulb, retrolateral view. Abbreviations: C = conductor; E = embolus; EP = embolar part; EPA = embolar part apophysis; RTA = retrolateral tibial apophysis; ST = subtegulum. Scale bars: 0.1 mm (equal for A and B, equal for C-E).
Figure 3. Clubiona jiugong sp. nov., female paratype and male holotype. A. Intact epigyne, ventral view; B. Cleared epigyne, ventral view; C. Cleared vulva, dorsal view; D. Vulva, cleared and embedded in Arabic gum, dorsal view; E. Male habitus, dorsal view; F. Male habitus, lateral view; G. Female habitus, dorsal view; H. Female habitus, ventral view. Abbreviations: BS = bursa; CD = copulatory duct; CO = copulatory opening; H = hood; SP = spermatheca. Scale bars: 0.1 mm (equal for A-D); 1 mm (equal for E and F, equal for G and H).
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
Genus |