Terebellides gracilis Malm, 1874

Barroso, Maria, Moreira, Juan, Capa, Maria, Nygren, Arne & Parapar, Julio, 2022, A further step towards the characterisation of Terebellides (Annelida, Trichobranchidae) diversity in the Northeast Atlantic, with the description of a new species, ZooKeys 1132, pp. 85-126 : 85

publication ID

https://dx.doi.org/10.3897/zookeys.1132.91244

publication LSID

lsid:zoobank.org:pub:4168C32E-37A7-4912-A909-4912E69030AA

persistent identifier

https://treatment.plazi.org/id/96856AFC-136E-5E9E-BFD7-E498F5D59E97

treatment provided by

ZooKeys by Pensoft

scientific name

Terebellides gracilis Malm, 1874
status

 

Terebellides gracilis Malm, 1874 View in CoL

Figs 2E, F View Figure 2 , 3F View Figure 3 , 4D View Figure 4 , 9 View Figure 9 , 10F View Figure 10 , 11 View Figure 11 , 12 View Figure 12 , 16 View Figure 16 , 17 View Figure 17 , 18 View Figure 18

Terebellides gracilis Malm, 1874: 67-105, p. 100.

Terebellides gracilis Species 3 - Nygren et al. 2018: 18-22, figs 6, 10.

Material examined.

20 specimens (Suppl. material 1), Skagerrak ( GNM15110, GNM15111 ); Norwegian coast (ZMBN116276, ZMBN116278, ZMBN116282, ZMBN116283, ZMBN116284, ZMBN116285, ZMBN116287, ZMBN116289, ZMBN116293, ZMBN116295, ZMBN116297, ZMBN116298, ZMBN116301, ZMBN116306, ZMBN116307, ZMBN116309, ZMBN116310, 116313) .

GenBank accession numbers of material examined (COI).

MG024583, MG024584, MG024585, MG024586, MG024587, MG024588, MG024589, MG024590, MG024591, MG024592, MG024593, MG024594, MG024595, MG024596, MG024597, MG024598, MG024599, MG024600, MG024601, MG024602, MG024603, MG024604, MG024605, MG024606, MG024607, MG024608, MG024609, MG024610, MG024611, MG024612, MG024613, MG024614, MG024615, MG024616, MG024617, MG024618, MG024619, MG024620, MG024621, MG024622, MG024623, MG024624, MG024625, MG024626, MG024627, MG024628, MG024629, MG024630, MG024631, MG024632, MG024633, MG024634, MG024635, MG024636, MG024637 .

Diagnostic features of studied material.

Complete individuals ranging from 5.0-29.0 mm in length (Fig. 9 View Figure 9 ). Branchial dorsal lobes lamellae provided with well-developed papillary projections and branchial ventral lobes provided with long posterior filaments, ranging from 125.0-175.0 µm in length (Fig. 16D, E View Figure 16 ). Between 23-32 lamellae on dorsal lobes (Figs 4C View Figure 4 , 16A, D, E View Figure 16 , 17A View Figure 17 ). Ciliary rows and ciliary tufts on inner branchial lamellae present (Figs 16B, C View Figure 16 , 17B View Figure 17 ). Ventral branchial lobes hidden in between dorsal ones but sometimes discernible below (Figs 16A, D View Figure 16 , 17A View Figure 17 ). Lateral lappets present on TC 1-4; dorsal projection of thoracic notopodia on TC 1-5 (Fig. 16D View Figure 16 ). White ventral colouration presents only on TC 4 (Figs 2E, F View Figure 2 , 3F View Figure 3 ). Geniculate chaetae present in TC 5, acutely bent, with marked capitium (Fig. 18A, B View Figure 18 ). Ciliated papilla dorsal to thoracic notopodia observed in TC 2-4 (Fig. 17A, C, D View Figure 17 ). From TC 7, neuropodia with one row of type 1 thoracic uncini per torus, with rostrum/capitium length ratio of ~ 2:1 and capitium with a first row of two or three large teeth, followed by many smaller teeth (Fig. 18C, D View Figure 18 ). Abdomen with 34-41 pairs of neuropodia with type 1A uncini (Fig. 18E, F View Figure 18 ).

Colour pattern.

MG staining characterised by compact green colourant in SG 1-5 and SG 7-13, SG 6 white and SG 14 striped (Fig. 12 View Figure 12 ). Similar to pattern 2.

Nucleotide diagnostic features.

All sequences of Terebellides gracilis share and are distinguished from other available Terebellides sequences in unique combinations of nucleotides (underlined) at the given position of our alignment: 39-63: TGGTACTTCAATAAGACTTCTTATC, 84-96: TGGGGCATTCCTG, 111-132: TTATAACACAATTGTTACTGCT, 138-157: TTTTTTAATAATTTTTTTCC, 216-234: TGCTCCTGATATAGCTTTC, 264-277: CCTCCCTCCAGCTT, 315-327: AGCTGGGACAGGT, 333-351: AGTCTACCCTCCTTTATCT, 381-399: AGATTTGGCTATTTTTTCT, 414-432: TATCTCCTCTATTCTTGGC¸ 450-545: TACA, 516-529: AAAAATCACTACCA, 543-552: TTCACTTCCT, 600-609: CACTTCCTTT, 630-640: CGACCCAATTT.

Type locality.

Atlantic Ocean, Norway ( Malm 1874).

Distribution and bathymetry.

South Iceland, Norwegian coast and shelf, Skagerrak; 237-1268 m deep (Figs 10F View Figure 10 , 11 View Figure 11 , Suppl. material 1).

Remarks.

Terebellides gracilis is a medium-sized species, reaching up to 29 mm in length and is characterised by the lack of papillae on margins of branchial lamellae, having branchiae of type 2 and filaments in ventral branchial lobes, presence of thoracic uncini of type 1 and abdominal uncini of type 1A (Table 1 View Table 1 ). As stated above, these features are shared with T. williamsae but both species differ in the pattern of white ventral thoracic colouration. Besides, they show a MG pattern close to type 2 but only T. gracilis showed J-shaped glandular regions in SG 3-5 as observed in the specimens studied here. Terebellides gracilis has apparently a more restricted geographical distribution than T. williamsae but reaching deeper depths (down to 1268 m).

Key to Northeast Atlantic Ocean species of Terebellides

The following key of European species of Terebellides is based on those by Lavesque et al. (2019) and Parapar et al. (2020a) but has been updated to include the species belonging to Groups B, C and D studied herein. The order of the presentation of the discriminating characters and the taxa has been changed to fit better with the clades recovered in the phylogenetic trees by Nygren et al. (2018) and Lavesque et al. (2019).

The characters considered were the ventral pigmentation of anterior thoracic chaetigers in live and fixed specimens, types of thoracic uncini (sensu Parapar et al. 2020b), morphology of branchiae (sensu Parapar et al. 2016a), morphology of the abdominal uncini (sensu Parapar et al. 2020a), the size of species (small species: <20 mm in length; medium: 20-40 mm; large:> 40 mm), the presence of geniculate chaetae in TC 5-6 or only in TC 6, the presence or absence of papillae in branchial lamellae margins, the shape of glandular region in TC 3, and the presence or absence of ciliary tufts in branchial lamellae. In those cases where two species are considered as cryptic and only distinguished by molecular characters, geographic and bathymetric distribution has been provided instead.

1 White ventral colouration on anterior thoracic chaetigers 2
- No distinct ventral colouration on anterior thoracic chaetigers 4
2 Medium/large species (>20 mm in length); 5th branchial lobe present; notochaetae of TC 1 similar to subsequent ones; main fang of thoracic uncini straight; thoracic uncini with capitium composed of 2-3 large teeth and subsequent ones much smaller 3
- Small species (<20 mm in length); 5th branchial lobe absent; notochaetae of TC 1 absent or shorter than subsequent ones; thoracic uncini with capitium composed of 4 or 5 mid-sized teeth and following of slightly smaller teeth T. ceneresi Lavesque, Hutchings, Daffe, Nygren & Londoño-Mesa, 2019
3 White ventral colouration on TC 1 to TC 4 T. williamsae Jirkov, 1989
- White ventral colouration only on TC 4 T. gracilis Malm, 1874
4 Branchial lobes all small and not fused; reduced dorsal lobes T. irinae Gagaev, 2009
- Branchiae otherwise 5
5 Lower branchial lobes with posterior projections as filaments; branchiae with lobes fused ~ 50% of their length or with lobes only fused at base; small/medium species (<40 mm in length) 6
- Lower branchial lobes with posterior projections; branchiae with large lobes almost completely fused; large species (> 40 mm in length) 9
6 Thoracic uncini with capitium composed of 5-7 small teeth, remaining ones similar in size at least in two rows T. shetlandica Parapar, Moreira & O’Reilly, 2016
- Thoracic uncini with capitium composed of 4-5 mid-sized teeth and followed by slightly smaller teeth 7
7 Branchiae with lobes fused ~ 50% of their length; medium-sized species (> 20 mm in length) T. lavesquei sp. nov.
- Branchiae with lobes only fused at base; small species (<20 mm in length) 8
8 Glandular region in TC 3 present; notochaetae from TC 1 longer than subsequent ones T. parapari Lavesque, Hutchings, Daffe, Nygren & Londoño-Mesa, 2019
- Glandular region in TC 3 not observed; all notochaetae of similar size T. atlantis Williams, 1984
9 Geniculate chaetae in TC 5 and TC 6; abdominal uncini with RvC = 1/0.7, capitium with 4-5 teeth and remaining ones smaller T. bigeniculatus Parapar, Moreira & Helgason, 2011
- Geniculate chaetae in TC 6 only 10
10 Branchial lamellae margins lacking papillae 11
- Branchial lamellae margins with papillae 13
11 Branchiae with lobes fused ~ 50% of their length T. gralli Lavesque, Hutchings, Daffe, Nygren & Londoño-Mesa, 2019
- Branchiae with large lobes almost completely fused 12
12 Abdominal uncini with RvC = 1/0.7, capitium with 4-5 teeth and remaining ones smaller T. stroemii Sars, 1835
- Abdominal uncini with RvC = 1/0.9, capitium composed of 3-5 large teeth in first row and 1-2 in a second row T. kongsrudi Parapar, Capa, Nygren & Moreira, 2020 and T. bakkeni Parapar, Capa, Nygren & Moreira, 2020
13 Glandular region in TC 3 round or oval 14
- Glandular region in TC 3 otherwise 15
14 Glandular region in TC 3 remained white with MG; branchial lamellae with rounded papillae; TC 1-3 without conspicuous dorsal projection T. lilasae Lavesque, Hutchings, Daffe, Nygren & Londoño-Mesa, 2019
- Glandular region in TC 3 stained blue with MG; branchial lamellae with conical papillae; TC 1-3 with conspicuous dorsal projection T. bonifi Lavesque, Hutchings, Daffe, Nygren & Londoño-Mesa, 2019
15 Branchial ciliary tufts present T. gentili Lavesque, Hutchings, Daffe, Nygren & Londoño-Mesa, 2019
- Branchial ciliary tufts absent 16
16 Most branchial lamellae with marginal papillae; mouth with upper lip elongated T. resomari Lavesque, Hutchings, Daffe, Nygren & Londoño-Mesa, 2019
- Only anterior branchial lamellae with marginal papillae; upper lip not elongated 17
17 Thoracic uncini with capitium composed of 2-3 large teeth and subsequent ones much smaller T. ronningae Parapar, Capa, Nygren & Moreira, 2020
- Thoracic uncini with capitium composed of 4 or 5 mid-sized teeth and following slightly smaller ones 18
18 Deep-water species; usually at depths below 200 m T. norvegica Parapar, Capa, Nygren & Moreira, 2020
- Shallow-water species; mostly at depths above 100 m T. europaea Lavesque, Hutchings, Daffe, Nygren & Londoño-Mesa, 2019 and T. scotica Parapar, Capa, Nygren & Moreira, 2020

Kingdom

Animalia

Phylum

Annelida

Class

Polychaeta

Order

Terebellida

Family

Trichobranchidae

Genus

Terebellides

Loc

Terebellides gracilis Malm, 1874

Barroso, Maria, Moreira, Juan, Capa, Maria, Nygren, Arne & Parapar, Julio 2022
2022
Loc

Terebellides gracilis

Malm 1874
1874
Loc

Terebellides gracilis

Malm 1874
1874