Euglyphis jessiehillae Montero

Montero-Ramírez, José Joaquín, Janzen, Daniel H. & Hallwachs, Winnie, 2011, A distinctive new species of Euglyphis Hübner (Lepidoptera: Lasiocampidae) from Costa Rica, with a checklist of the Euglyphis known from Costa Rica, Zootaxa 3020, pp. 49-59 : 51-53

publication ID

https://doi.org/ 10.5281/zenodo.202314

DOI

https://doi.org/10.5281/zenodo.6192340

persistent identifier

https://treatment.plazi.org/id/8C3287EA-552B-DA42-03B4-64A7FB2AF015

treatment provided by

Plazi

scientific name

Euglyphis jessiehillae Montero
status

sp. nov.

Euglyphis jessiehillae Montero View in CoL , new species

( Figs. 1–20 View FIGURES 1 – 4. 1 – 2 View FIGURES 5 – 15. 5 – 12 View FIGURES 16 – 20 )

Diagnosis. Distinguished from other Euglyphis males by having a bright creamy-yellow patch in the forewing ventral surface, and females with a dark spot at the end of the discal cell and a creamy-yellow apical dash in the forewing dorsal surface.

Description. Male, except as otherwise indicated. Forewing length 14.2–15.4 mm (male); 20.3–22.5 mm (female). Head: frons and vertex hairy, with reddish-brown and pale yellow piliform scales. Labial palpus porrect, with yellow base and fuscous tip laterally, pale yellow mesally. Proboscis absent. Males with antenna bipectinate to the tip, with shorter rami in females; shaft densely covered with fuscous scales with pale yellow tips; pedicel with lateroventral tufts of pale yellow scales with fuscous base.

Thorax: densely covered with reddish brown pilose scales with pale yellow tips; ventrally with creamy-yellow scales anteriorly, light brown or dark gray in females; dark gray to light brown at posterior end. Dense and long reddish-brown and pale yellow mixture of piliform scales on dorsum of legs, gray and pale yellow in females; creamy-yellow ventrally. Forewing ( Figs. 1–4 View FIGURES 1 – 4. 1 – 2 ) upper side dark brown with a dark spot at end of discal cell, between the stem of Rs4-M1 and M2; costal and outer margin with dark brown scales; inner margin with reddishbrown and pale yellow mixture of piliform scales; female similar in pattern, but light brown. Subterminal line creamy-yellow, thin and wavy, arising from tornus to subapex, parallel to outer margin; postmedial line with a mixture of reddish-brown and creamy-yellow scales; running parallel to median line that is represented by creamy-yellow punctiform spots on every vein; terminal line reddish brown; light brown in ventral surface. Male underside dark brown with bright yellow patch, from basal area to tornus and below vein Cu1 and the lower edge of discal cell; female light brown and without bright yellow patch. Hindwing inner margin with pale brown pilose scales, costal and outer margin with dark reddish brown scales. Fringes of both wings with creamy-yellow punctiform spots at the end of every vein; spots also present in ventral surface.

Abdomen: dark brown with long reddish brown setae on terminal part. Male tergite and sternite of eight abdominal segment plate-like, as figured ( Figs. 6, 8 View FIGURES 5 – 15. 5 – 12 ). Male genitalia ( Figs. 9–13 View FIGURES 5 – 15. 5 – 12 ): well-developed claw on end of uncus and apex strongly sclerotized, hairy and curved. Gnathos flat and spatulate. Valva with wide base, narrowing from middle to apex, inner surface without setae, sacculus membranous and hairy. Transtilla with membranous cap. Juxta with broad, v-shaped process below aedeagus, arms of process triangulate and hairy; connected to dorsoventral plate at base. Aedeagus short and slightly downcurved from middle to distal end, apex with two rounded processes, one dorsal and other, ventral and longer; vesica without cornuti. Saccus well developed and triangulate. Female genitalia ( Figs. 14–15 View FIGURES 5 – 15. 5 – 12 ): Ostium bursae in shallow depression, sclerotized and smooth. Antrum of ostium bursae sclerotized and narrow, with ovoid corpus bursae. Ductus seminalis connects just below antrum. Ductus bursae corrugated, and about half length of corpus bursae. Signum absent. Anterior and posterior apophysis elongated, posterior apophysis slightly longer than anterior apophysis. The male and female genitalia are overall quite distinctively different in form from those of all other Costa Rican Euglyphis .

Etymology. Euglyphis jessiehillae is named in honor of Jessie Hill of Philadelphia and Hawaii, as recognition of her years of support of the parataxonomists who find and rear this moth and thousands of other species of ACG moths, and her conservation of the ACG rain forest occupied by a healthy population of this moth.

Distribution: E. jessiehillae is currently known only from Area de Conservacion Guanacaste in northwestern Costa Rica, from 100 to 1150 m, and one site in Area de Conservación Osa in southern Costa Rica (100 m) ( Fig. 21 View FIGURE 21 ). It is likely to occur throughout the same ecosystem elsewhere in Costa Rica, but since it is not collected in light traps, its distribution will not be known until it is encountered through caterpillar inventory or pheromone trapping.

Material examined. 14 specimens (8 3, 6 Ƥ).

Holotype. (3), Costa Rica: Guanacaste Province, Sector Cacao, Rancho Harold, 820 m, Latitude: 10.90475 Longitude: -85.46803, caterpillar collection date: 1 Apr 2004, adult eclosion date: 17 Apr 2004, collector: Dunia Garcia, (04-SRNP-45269), Genitalia slide JMR2010-3. Holotype deposited in INBio. Labelled (yellow): LEGS AWAY / FOR DNA. Holotype DNA barcode:

MHAOA 171-06|04-SRNP-45269| Euglyphis Janzen 01|COI-5P:

ACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCATTAAGTTTACTAATTCGAGC TGAATTAGGAACCCCTGGATCTTTAATTGGAGATGATCAAATTTACAATACTATTGTTACAGCTCATGCT TTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGGGGATTTGGAAATTGATTAGTCCCCCTTATA TTAGGAGCTCCTGATATAGCCTTCCCACGAATAAATAATATAAGATTTTGACTACTTCCCCCATCATTAA CCCTTTTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGTACAGGATGAACAGTTTACCCCCCACTA TCATCTAATATTGCTCATGGTGGAGGATCAGTTGATTTAGCTATTTTTTCTCTTCATTTAGCTGGAATTTC TTCAATTCTAGGAGCTATTAATTTTATTACAACTATTATTAACATACGATTAAACAATATATCTTTTGATCA AATACCTCTATTTGTATGAGCTGTAGGTATTACAGCCTTTCTTCTCCTACTATCTTTACCCGTTCTTGCTG GAGCAATTACTATATTACTCACAGATCGAAACTTAAATACTTCTTTTTTTGACCCTGCCGGAGGGGGAG ACCCTATCTTATATCAACATTTA. GenBank accession number: GU203708 View Materials .

Paratypes. Costa Rica: Guanacaste Province, (1 3), Estación Pitilla, 9 Km. S. de Santa Cecilia, 700 m, May 1995, Latitude: 10.990357 Longitude: -85.427182, Coll. C. Moraga, (INBIOCRI002172719), Genitalia slide JMR2010-2, ( INBio). (1 Ƥ), Sector Cacao, Sendero Nayo, 1090 m, Latitude: 10.92446 Longitude: -85.46953, collection date: 19 Feb 2003, adult eclosion date: 26 Mar 2003 (03-SRNP-3388), ( INBio). (1 Ƥ), Estacion Cacao, 1150 m, Latitude: 10.92691 Longitude: -85.46822, collection date: 19 Nov 2003, collector: Ruth Franco (03- SRNP-23973), ( INBio); (1 Ƥ), collection date: 28 Jun 1998, adult eclosion date: 21 Jul 1998, collector: Mariano Pereira (98-SRNP-3152), Genitalia slide JMR2010-6, ( INBio). (1 Ƥ), Quebrada Heliconia, 390 m, Lat: 10.88585 Long: -85.49222, collection date: 20 Jun 2006, adult eclosion date: 0 6 Jul 2006, collector: Manuel Pereira, (06- SRNP-45503), Genitalia slide JMR2010-5, ( INBio). (1 3), Quebrada Heliconia, collection date: 8 Jan 2006, adult eclosion date: 30 Jan 2006, collector: Harry Ramirez, (06-SRNP-45075), ( U.S. N.M.). (1 3), Sector Mundo Nuevo, Porton Rivas, 570 meters, Latitude: 10.75864 Longitude: -85.37269, collection date: 16 Nov 2005, adult eclosion date: 3 Dic 2005, collector: Mariano Pereira, (05-SRNP-65806), ( INBio). Alajuela Province: (1 Ƥ), Sector San Cristobal, Quebrada Cementerio, 700 m, Latitude: 10.87124 Longitude: -85.38749, collection date: 8 May 1997, adult eclosion date: 0 4 Jun 1997, collector: gusaneros, (97-SRNP-6042), ( U.S. N.M.); (1 3), collection date: 8 May 1997, adult eclosion date: 29 Aug 1997, collector: gusaneros, (97-SRNP-6040) ( INBio). (1 3), Potrero Argentina, 520 meters, Latitude: 10.89021 Longitude: -85.38803, collection date: 23 Jun 2001, adult eclosion date: 12 Jul 2001, collector: Carolina Cano , (01-SRNP-2295), Genitalia slide JMR2010-4, ( INBio). (1 Ƥ), Puente Palma, 460 m, Latitude: 10.9163 Longitude: -85.37869, collection date: 30 Jul 2004, adult eclosion date: 10 Sep 2004, collector: Yessenia Mendoza, (04-SRNP-3717), ( INBio). (1 3), Finca San Gabriel, 645 m, Latitude: 10.87766 Longitude: -85.39343, collection date: 0 2 Jul 2005, adult eclosion date: 23 Aug 2005, collector: Gloria Sihezar, (05- SRNP-3707), ( INBio). Puntarenas Province: (1 3), Estación Sirena, P.N. Corcovado, 100 m, Jan 1994, Latitude: 8.480171 Longitude: -83.591289, Colls J.F. Corrales, B. Espinosa, (INBIOCRI001985962), Genitalia slide JMR2010-1, ( INBio).

GenBank accession numbers for the DNA barcodes (COI-5P) of 45 reared specimens of Euglyphis jessiehillae : 08-SRNP-57379 GU648075; 03-SRNP-4191 GU203707 View Materials ; 04-SRNP-45269 GU203708 View Materials ; 05-SRNP-65806 GU203716 View Materials ; 05-SRNP-49640 GU203702 View Materials ; 05-SRNP-25532 GU203699 View Materials ; 05-SRNP-35322 GU203700 View Materials ; 06-SRNP- 45021 GU203701 View Materials ; 05-SRNP-25430 GU203704 View Materials ; 05-SRNP-49583 GU203703 View Materials ; 06-SRNP-45075 GU203713 View Materials ; 05- SRNP-35319 GU203717 View Materials ; 05-SRNP-59687 GU203718 View Materials ; 04-SRNP-1198 GU203710 View Materials ; 07-SRNP-35968 GU203691 View Materials ; 07-SRNP-58052 GU203692 View Materials ; 07-SRNP-45620 GU203693 View Materials ; 07-SRNP-59297 GU203694 View Materials ; 07-SRNP-45619 GU203695 View Materials ; 07-SRNP-45618 GU203696 View Materials ; 07-SRNP-58053 GU203697 View Materials ; 08-SRNP-35517 GU648066; 08-SRNP- 2099 GU648065; 08-SRNP-609 GU648064; 08-SRNP-57386 GU648071; 08-SRNP-4712 GU648069; 08-SRNP- 57628 GU648068; 08-SRNP-5949 GU648074; 08-SRNP-57710 GU648073; 08-SRNP-57454 GU648072; 08- SRNP-57448 GU648079; 08-SRNP-1565 GU648078; 08-SRNP-610 GU648077; 08-SRNP-56538 GU648083; 08- SRNP-6277 GU648082; 06-SRNP-36109 GU203690 View Materials ; 06-SRNP-36108 GU203689 View Materials ; 06-SRNP-3108 GU203688 View Materials ; 04-SRNP-4877 GU203714 View Materials ; 05-SRNP-3707 GU203715 View Materials ; 04-SRNP-32031 GU203705 View Materials ; 04-SRNP-32032 GU203706 View Materials ; 04-SRNP-60471 GU203711 View Materials ; 05-SRNP-151 GU203709 View Materials ; 03-SRNP-6188 GU203712 View Materials

INBio

National Biodiversity Institute, Costa Rica

FOR

Forssa Museum of Natural History

DNA

Department of Natural Resources, Environment, The Arts and Sport

Kingdom

Animalia

Phylum

Arthropoda

Class

Insecta

Order

Lepidoptera

Family

Lasiocampidae

Genus

Euglyphis

GBIF Dataset (for parent article) Darwin Core Archive (for parent article) View in SIBiLS Plain XML RDF