Unemaeea nathalieae Tedersoo, 2024

Tedersoo, Leho, Magurno, Franco, Alkahtani, Saad & Mikryukov, Vladimir, 2024, Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes), MycoKeys 107, pp. 249-271 : 249-271

Unemaeea nathalieae Tedersoo sp. nov.

Diagnosis.

Separation from other species of Unemaeea based on the ITS region (5.8 S positions 122–151 gtcagtgtttgccacggagtatgccggctt; no mismatch allowed) and from other species of Endogonomycetes based on LSU (positions 694–723 gggcttgtcatggcagagggacacgtcgta; no mismatch allowed) as indicated in Fig. 17 .

Type.

Soil eDNA sample TUE 100213 (holotype); eDNA sequence EUK 1630871 (lectotype); GSMc plot G 3318, marshland (soil sample TUE 000213 ) in Unemäe , Estonia, 58.28253 ° N, 22.46296 ° E .

Description.

Other sequences: EUK 1635887 – EUK 1635890 (type locality) and EUK 1213720 (FunAqua sample W 0581 s, river sediment in Floresti, Romania, 46.75472 ° N, 23.49923 ° E).

Etymology.

Unemäe (Estonian) refers to the type locality; and Nathalie (English) refers to the first name of Nathalie J. A. Curlevski who collected the first materials belonging to this genus.

Notes.

The end of 5.8 S and start of LSU are strongly diverged compared with other species of Unemaeea and Endogonomycetes. As no other confamilial LSU sequences are available, the diagnostic positions are compared against the most divergent, unalignable part across Endogonomycetes. Found in anoxic soil in Estonia and Romania, with ITS sequences displaying up to 4 % differences.

Figures

Figure 17. Diagnostic barcodes for Unemaeea nathalieae relative to closely-related taxa in ITS 2 and LSU.