Orasema minutissima, Howard

Heraty, John M., Rogers, D. Valle, Johnson, M. Tracy, Perreira, William D., Baker, Austin J., Bitume, Ellyn, Murray, Elizabeth & Varone, Laura, 2021, New record in the Hawaiian Islands of Orasema minutissima (Hymenoptera: Eucharitidae), an ant-parasitic wasp and a potential biocontrol agent against the Little Fire Ant, Wasmannia auropunctata (Hymenoptera: Formicidae), Bishop Museum Occasional Papers 137, pp. 7-18 : 9-17

Sampling. The first observation of O. minutissima

was made by DVR in Hilo using Yellow Pan Traps (YPT) that consisted of a yellow plastic bowl [i.e., 13.5 oz (0.4 liter), 7" × 1 ¾" (17.5 cm × 4.5 cm)], with water and a few drops of non-scented liquid soap, that was placed on the ground. Similar YPT traps were used by MTJ and EB at Hilo and the Keauohana Forest Reserve, two sites known to be infested by Wasmannia . WDP had been monitoring several sites in Hawai‘i ( Fig. 2 ), Maui, and O‘ahu as part of a separate insect survey project. On Maui and O‘ahu, Wasmannia was not present at either site being sampled, but Pheidole were present. His YPTs consisted of yellow 8 ounce (0.24 liter) plastic “shave ice” flower cups, readily available at local restaurant supply stores and online, filled with water and about 5 ml of yellow colored dish soap; traps were placed in the field for two weeks and the specimens air-dried. Bowl size (larger or smaller) is not likely to affect monitoring for presence or absence of O. minutissima . WDP also sampled with Yellow Sticky Board Traps (YSBT) consisting of 10" × 12" (25.40 cm x 30.48 cm) cards from HTG Supply (htgsupply.com; Callery, PA) cut into 10" × 3" (25.4 cm × 7.5 cm) strips and hung from branches approximately 3–4 ft (0.91–1.22 m) above ground at each field location ( Fig. 2 ). After two weeks, the YSBTs were replaced with new traps and specimens stuck to the exposed traps were removed using Aliphatic Naphtha (Crown Brand V.M.&P. NAPHTHA ®), soaked in same solutions for about one hour until all adhesive materials were dissolved, and then air-dried. Specimens of Orasema were either airdried or chemically dried from ethanol using HMDS ( Heraty & Hawks 1998) and then point-mounted and deposited in either the Entomology Research Museum, University of California, Riverside, CA (UCRC_ENT) or the Bernice P. Bishop Museum, Honolulu, HI (BPBM) (Appendix). Individuals were assigned a unique barcode and databased in the Heraty lab FileMaker Pro database.

Sequencing. Specimens from 95% ethanol were extracted using DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA, USA) with 1 μL RNase A added after incubation. PCR products were purified with DNA Clean & Concentrator-5 kits (Zymo Research, Irvine, CA, USA). PCR product concentrations were determined using Nanodrop 2000c (Thermo Scientific, Waltham, MA, USA). Two regions of ribosomal DNA were PCR amplified individually and Sanger-sequenced with the following primer sequences: 28S D2 rDNA (D2-F: CGGGTTGCTTGAGAGTGCAGC; D2-Ra: CTCCTTGGTCCGTGTTTC) and ITS2 (ITS2-F: TGTGAACTGCAGGACACATG; ITS2-R2: TCTCGCCTGCTCTGAGGT). The following thermocycler protocol was used: initial denaturization: 94 °C 3 min., 34 cycles Table 1. Orasema minutissima specimens sequenced.

specimen id 28S-D2 ITS2 Country size class D number

235958 KY349472 * MW575764 Brit. Virgin Islands small 0424

235964 KY349465 * MW575761 St. Lucia small 0437

235966 KY349458 * MW575757 Dominica medium 2766

235967 — identical Dominica medium 2765

235968 KY349457 * MW575758 Dominica medium 2764

235969 KY349463 * identical Dominica small 2763

235970 KY349462 * MW575760 Dominica small 2762

271392 KY349464 * MW575762 Dominica small 2830

271393 KY349459 * identical Dominica medium 2831

271395 KY349456 * MW575756 Dominica large 2833

412118 KY349466 * identical Trinidad small 3800

412119 KY349467 * MW575763 Trinidad small 3801

412127 KY349469 * identical Trinidad small 3809

412131 KY349471 * identical Trinidad small 3814

412132 KY349470 * — Trinidad small 3810

447074 KY349473 * — Colombia small 4207

447075 KY349455 * MW575755 Colombia small 4208

456205 identical identical Puerto Rico small 2808

468543 MW357878 MW357873 Hawai‘i small 6943

468544 MW357879 identical Hawai‘i small 6944

28S-D2 GenBank accession numbers marked by an asterisk were used in Burks et al. (2018); ITS2 accessions are all new. Specimen ID numbers are associated with a prefix UCRC _ENT00 and deposited in UCRC, with full collection data presented in Appendix 1. D numbers are the DNA voucher codes. Identical refers to sequences that were captured but not deposited in GenBank.

(94 °C 1 min.; 55 °C 1 min., 72 °C 1 min.), final extension: 75 °C 7 min. PCR samples were sent to Retrogen Inc (San Diego, CA, USA) for Sanger sequencing on an Applied Biosystems 3730xl DNA Analyzer. Deposition of molecular vouchers is indicated in the Material Examined sections. GenBank accession numbers are listed in Table 1.

Measurements. To investigate the different size classes within O. minutissima and infer the ant host, measurements were taken for 31 specimens of the total body length (anterior margin of head to apex of gaster) and fore wing length (apex of humeral plate to most distal margin of wing membrane). For specimens from Hawai‘i, all of the small specimens were measured from material that was dried using the HMDS method; the two larger specimens were air-dried but this appeared to have minimal impact on body length. Identification numbers for specimens measured are UCRC_ENT00422315–16, 422320, 468555–67, 468588 (see Appendix for details). Measurements of the Neotropical material included specimens of three size classes (small, medium, large) from across the range of O. minutissima , including the British Virgin Islands, Colombia (Gorgona Island), Dominica, Puerto Rico, and Trinidad (Appendix); all of these specimens were dried with HMDS. For the Neotropical specimens, we chose only material that had been sequenced for either 28S-D2 or ITS2 (all with identical sequences) to guarantee that they were all forms with the identical haplotype of O. minutissima .

RESULTS AND DISCUSSION

Distribution in Hawai‘i

To date, O. minutissima has only been collected in the vicinity of Hilo on the island of Hawai‘i at or near sites 5, 6, 8, 10 and 13 despite continuous trapping at the other sites ( Fig. 2 , Appendix). Orasema minutissima (Howard) was first discovered on the island of Hawai‘i near Hilo in October 2019 ( Fig. 1 ) using yellow pan traps (YPTs, Fig. 1C ). Subsequent sampling in September 2020 at two sites on Hawai‘i Island by MTJ found O. minutissima in at least half of 24 YPTs at one site and in most of 10 traps at another, with as many as 10 wasps collected in an individual trap, suggesting that the species is well established ( Fig. 1D ). Additional collections made during a survey initiated across Hawai‘i in April 2019 using yellow sticky board traps (YSBT) and a different type of YPT recovered O. minutissima at 5 out of 17 sites where Wasmannia was also present ( Fig. 2 ). Of the sites where no Orasema were collected, only site 7 (Hilo) and 17 (Whittington Beach Park) are low enough in elevation to also have Wasmannia ; the other sites with no Orasema are likely too high (> 1800 m) to have Wasmannia . From this limited sampling, it is unclear if the Orasema is distributed only in eastern Hawai‘i, or if it may be more widespread across the island. Mostly females have been recovered, but one male was sampled on a YSBT at site 8. Sampling using both YPTs and YSBTs failed to recover these wasps from either O‘ahu or Maui, suggesting that it is established only on the island of Hawai‘i, although none of the sites sampled had Wasmannia present. This is the first record of a eucharitid wasp in the Hawaiian Islands, and its accidental introduction has the potential to offer some form of biological control over the invasive LFA.

Sequencing

Two gene regions, 28S-D2 and ITS2, were sequenced for two of the specimens from Hilo following the protocols and primers outlined in Baker et al. (2020) and Burks et al. (2018). The second ITS2 read for D6944 was not of high enough quality to deposit on GenBank but was identical for the sequence obtained. The 28S-D2 sequences were identical to other specimens of O. minutissima that have been sequenced from the Caribbean and Colombia (Gorgona Island) ( Burks et al. 2018), and for the ITS2 obtained in this study ( Table 1).

Origin of Orasema minutissima

There have been no purposeful introductions of this wasp to Hawai‘i. It is most likely that they were imported along with a new accidental importation of Wasmannia . Given that O. minutissima is not known to occur in Florida, it is not likely to have come with the initial population from Florida, which was the place of origin proposed by Mikheyev & Mueller (2007) and Foucaud et al. (2010). Thus, a separate introduction of Wasmannia from one of the localities where it is currently distributed, along with its parasitoid, is inferred. However, given that the current gene regions of the wasp have identical haplotypes across the range of the species, no further inference of origin can be made at this time.

Measurements and size classes

A total of 13 specimens were measured from Hawai‘i and another 18 from various Neotropical islands ( Fig. 3 ). All but two of the specimens from Hawai‘i fell into the small size morph class, which is associated with parasitism of Wasmannia ( Burks et al. 2018) . The two larger sized specimens appear to be intermediate in size to the medium and large morphs from the Neotropical material ( Fig. 3 ). The number of measurements for the Neotropical specimens is meager, but we felt it important to only measure sequenced specimens, as closely related species in the complex can be difficult to separate based on morphology alone ( Burks et al. 2018). Larger samples from the Caribbean support the separation of size classes, but the large and medium classes are rarely sampled. Pupae of the small size class have been found only with with brood of Wasmannia in the Caribbean. A single pupa of a medium-size morph was recovered from a nest of Pheidole in Dominica, and in an area where both the medium and large morph specimens were collected. We assume that the medium and large size classes are associated with different castes of Pheidole . On Hawai‘i, we assume that the larger size class also indicates an association with Pheidole ; however, it is also possible that they are developing on the queen brood of Wasmannia .

Host plants

In Jamaica, Orasema minutissima have been collected from Chamissoa altissima (Jacq.) Kunth (Amaranthaceae) , Gynerium sagittatum (Аubl.) Beauv. (Роасеае) and Zapoteca ? formosa (Kunth) H.M. Herm. ( Fabaceae ), although no oviposition was observed ( Heraty 1994a; Burks et al. 2018). In Dominica, the small morph has been observed to oviposit on ferns ( Cyathea tenera (J.E. Smith) Moore , Cyathaceae; Nephrolepis biserrata Schott , Polypodiaceae ; Thelypteris opposita (Vahl) Ching , Thelypteridaceae ), whereas the larger size morphs preferentially oviposit on a variety of short (6–12" high) broad-leaf plants ( Coccoloba uvifera L., Polygonaceae ; Simarouba amara Aublet , Simaroubaceae ; miscellaneous Fabaceae and Rubiaceae ). Single eggs are deposited into excavations made into the leaf surface by the enlarged ovipositor ( Fig. 1B ), with the punctures usually surrounded by a brown scarring of the leaf tissue. In east Hawai‘i, egg punctures, eggs and planidia have been found on alien swordfern ( Nephrolepis brownii (Desv.) Hovenkamp & Miyam. , Polypodiaceae ) ( Fig. 1E ), a ground fern with large-lobed fronds ( Microsorum grossum (Langsdorff & Fischer) S.B. Andrews , Polypodiaceae ), and strawberry guava ( Psidium cattleyanum Sabine , Myrtaceae ) at the Keauohana Forest Reserve site. While the oviposition scars may cause some cosmetic damage when numbers are high, the leaves usually recover as they mature.

Biological control potential

Heraty (1994a) proposed that O. minutissima was one of the few species that may have an impact as a biological control agent against Wasmannia . When present, especially in moist island habitats in the Caribbean, O. minutissima can be extremely common. However, their impact on the ant population numbers has not yet been assessed within an experimental framework. Their purposeful importation as a biological control agent to other islands, especially to islands in the Pacific, has not been implemented. The primary issues for treating this as a coordinated biological control effort lie with the difficulty of transport and a need for quarantining with the capability for continuous rearing to test for negative impacts against native species. With regard to the Hawaiian introduction, there are no native myrmicine ants on any of the Hawaiian Islands, and in any case Oraseminae are specific only to that ant subfamily ( Murray et al. 2013; Baker et al. 2020). The impacts of cosmetic damage to native vegetation will likely be minimal, but this should be assessed in the future. It will be necessary to sample for presence of the wasp on island locations that have Wasmannia present to assess the presence and spread of Orasema . However, O. minutissima has been discovered at a time where the spread of the parasitoid and its impact on Wasmannia , and potentially Pheidole , can be monitored to see if they have any effect on lowering population densities.

Appendix. Material examined for this study.

Hawaiian Material Examined (deposited in UCRC or BPBM, with UCRC _ENT00 code [abbreviated UC]; DNA number = Dxxxx): USA: Hawaiian Islands: Hawai‘i I. : Hilo, 112 m, 19°41'52"N 155°05'44"W, 14-17 Oct 2019, Valle Rogers, along boundary between lawn and forest, YPT, 0406.19 [6♀, BPBM: UC422320, UCRC: UC468543 ( D6943 ), UC468544 ( D6943 ), UC468555–57 ]. Hilo , 108 m, 19°41'56"N 155°05'45"W, 18 Sep 2020, M.T. Johnson, vegetation along outside fence, YPT [23♀, BPBM: UC422386–95 , UCRC: UC499508–20 ]. Kalapana, Kaimu, Chain of Craters Road, mi 21 , 18 m, 19°21'40"N 154°58'38"W, 28 Nov–12 Dec 2020, W.D. Perreira, YBST [17♀, UCRC: UC4995722–38 ]. Kaumana Dr. , 434 m, 19°40'52"N 155°09'20"W, 28 May–8 Jun 2020, W.D. Perreira, YSBT [1♀, UCRC: UC468563 (large form)]. Kawainui Stream , 65m, 19°49'13"N 155°05'42"W, 26 Oct–9 Nov 2019, W.D. Perreira, YSBT [1♀, UCRC: UC468558]. Pahoa District Park , 200 m, 19°29'35"N 154°56'51"W, 29 Feb–14 Mar 2020, W.D. Perreira, YSBT [2♀, BPBM: UC422315–16 (16 = large form)]. Pahoa District Park , 200 m, 19°29'35"N 154°56'51"W, 8–22 Jun 2020, W.D. Perreira, YSBT [3♀, UCRC: UC468559–61 ]. Pana‘ewa Zoo , 35 m, 19°19'16"N 155°04'16"W, 27 Dec–8 Jan 2020, W.D. Perreira, YSBT [40♀ 1♂, UCRC: UC499539–79 ]. Pana‘ewa Zoo , 35 m, 19°19'16"N 155°04'16"W, 8–20 Jun 2020, W.D. Perreira, YSBT [1♀, UCRC: UC468562]. Hwy 130, Keauohana For. Res. , 240 m, 19°24'51"N 154°57'08"W, 25 Sep 2020, M.T. Johnson, along forest edge, YPT [10♀, BPBM: UC422317–19 , UCRC: UC499501–507 ] .

Neotropical Material Examined (deposited in UCRC, with UCRC _ENT00 code [abbreviated UC], unless otherwise indicated; DNA number = Dxxxx followed by size class:s = small, m = medium, l = large; coordinates in italics estimated from google earth): British Virgin Islands: Tortola: Mt. Sage Nat. Pk. , Sage Mt. , 18°24'14"N 64°39'39"W, 10 Dec–8 Jan 1993, M.A. Ivie & T. Hughes, nr. toilets, flight intercept trap #4 [1♀, UC235958 ( D0424s )]. Colombia: Cauca: PNN Gorgona, El Saman , 5m, 2°58'0"N 78°11'0"W, 6–22 Mar 2001, H. Torres, Malaise trap, M.1476 [1♀, UC447075 ( D4208 s)]. PNN Gorgona, El Saman, 5 m, 2°58'0"N 78°11'0"W, 7–25 May 2001, H. Duque, malaise trap, M.1844 [1♀, UC 447074 (D4207s)]. Dominica: Central Forest Reserve , 337 m, 15°26'29"N 61°19'40"W, 15 May 2009, J. Heraty, rainforest, sweep, H09-018 [1♀, UC235970 ( D2762s )]. Northern Forest Reserve Sympa trail (upper site) , 390 m, 15°31'55"N 61°21'35"W, 14 May 2010, J. Heraty, H10-016 [3♀, UC271392 ( D2830s), UC271393 (D 2831m ), UC271395 ( D 2833l)]. Sulphur Springs, pools trail , 290 m, 15°14'21"N 61°20'50"W, 16 May 2009, J. Heraty, rainforest, sweep, H09-019 [2♀, UC235966 ( D 2766m ), UC235967 ( D 2765m )]. Sulphur Springs, pools trail , 290 m, 15°14'21"N 61°20'50"W, 20 May 2009, J. Heraty, rainforest, sweep, H09-025 [2♀, UC235968 ( D 2764m ), UC235969 ( D2763s )]. Puerto Rico: Maricao: Maricao Forest, rd 120 km 17.9 , 18°10'51"N 66°58'48"W, 22 Oct 2002, Gates, rd edge and shrubs, sweep [1♀, UC456205 (D2808s)]. St. Lucia: W.I.: Barre del Isle, 13°52'23"N 60°58'1"W, 2 Mar 2000, L. Masner, forest trail, ss [1♀, UC235964 D0437s )]. Trinidad: Gasparillo, 10°18'57"N 61°25'7"W, 5–15 Nov 1987, R. Borneo , grass/forest edge, malaise trap, ROM 870031 [1♀, ROME: UC364799 ( D2810s )]. Maracas Falls, 190 m, 10°43'28"N 61°24'32"W, 16 Jul 2013, Heraty, forest, swp, H13-044 [2♀, UC412118 ( D3800s ), UC412119 ( D3801s )]. Maracas Falls, 190 m, 10°43'28"N 61°24'32"W, 23 Jul 2013, Heraty & Baker, forest, YPT/PB bait, H13-073 [3♀, UC412127 ( D3809s ), UC412131 ( D3814s ), UC412132 ( D3810 s)].

Figures

Fig. 2. Yellow Sticky Board sampling sites on Hawai‘i Island: (1) Koai‘a Tree Sanctuary; (2) Waimea Town; (3) UH Mealani Research Station; (4) Kalōpā State Recreation Area; (5) Kawainui Stream; (6) Kaumana; (7) Hilo Town; (8) Pana‘ewa Zoo; (9) Kurtistown; (10) Pahoa District Park; (11) Pu‘u Huluhulu; (12) Route 200 Saddle Road; (13) Kaimu-Chain of Craters Road; (14) Wright Road, Volcano Village; (15) Hawai‘i Belt Road; (16) Pahala and (17) Whittington Beach Park. Orasema minutissima were sampled at sites 5, 6, and 10 in 2019; at site 8 in 2019-2021; and at site 13 in 2020- 2021 (yellow circles). Satellite image credited to Google Earth.

Fig. 1. Orasema minutissima. A, habitus of dry-mounted specimen. B, habitus of ethanol-preserved specimen. C, yellow pan trap. D, portion of YPT sample with numerous O. minutissima females (yellow arrows). E, egg punctures (red arrows) in surface of swordfern leaf.

Fig. 3. Size classes of Orasema minutissima females. Neotropical refers to samples from various islands in the Caribbean and in the Pacific Ocean from Gorgona Island off the coast of Colombia (see Appendix 1). All Neotropical specimens measured were sequenced for 28S-D2, COI and ITS2, and have an identical haplotype (Burks et al. 2018 and this study).