Cryptes utzoni Lin, Kondo & Cook, 2018

Lin, Yen-Po, Kondo, Takumasa, Gullan, Penny J. & Cook, Lyn G., 2018, A newly recognised species of Cryptes Maskell 1892 (Hemiptera: Coccidae) from Western Australia, Zootaxa 4508 (1), pp. 101-114 : 108-112

Cryptes utzoni Lin, Kondo & Cook sp. n.

( Fig. 4 )

urn:lsid:zoobank.org:act:8509AE5F-35CB-4546-9E78-2217ED214152

Material examined. Holotype. Adult female (ID: LGC02307f6). Yeo Lake Nature Reserve, WA,/ Australia. - 28.08° S, 124.32° E./ ex Acacia aneura , 1.x.2013,/ L. G. Cook ( WAM: 1 female on 1 slide). GenBank accession numbers: 18S: MH 844470 ; 28S: MH 886632 ; COI: MH 886618 ; EF-1 α: MH 886635 .

Paratype. Adult female (ID: LGC02307f4). Same data as for holotype ( WAM: 1 female on 1 slide). GenBank accession numbers: 18S: MH 844468 ; 28S: MH886630 ; COI: MH886616 ; EF-1 α: MH886633 .

Paratype. Adult female (ID: LGC02307f5). Same data as for holotype ( ANIC: 1 female on 1 slide). GenBank accession numbers: 18S: MH 844469 ; 28S: MH886631 ; COI: MH886617 ; EF-1 α: MH886634 .

Paratypes. Adult females (ID: LGC02307f1, LGC02307f2). Same data as for holotype ( WAM: 2 females on 2 slides) .

Paratypes. Adult females (ID: LGC02307f3, LGC02307f7, LGC02307f8). Same data as for holotype ( ANIC: 3 females on 3 slides) .

Diagnosis. Adult females of C. utzoni can be identified and distinguished from C. baccatus and A. hakearum by the following combination of morphological character states (the contrasting states for the other two species are given in Table 3): (i) live adult female with a pale linear stripe with irregular black borders running longitudinally from head to area anterior to anal plates on mid dorsum; slide-mounted female with (ii) dorsal setae of two sizes; (iii) tubular ducts abundant on body margin and submargin on dorsum; on venter, present throughout more abundant near margin, but absent from anterior to mouthparts (iv) each anal plate almost half-circular in shape, appearing crescentic when open, with three apical setae and two discal setae; (v) marginal setae setose, often with slightly curved apices; (vi) sclerotised areas on derm near stigmatic spines absent; (vii) anterior stigmatic areas each with two stigmatic spines, posterior stigmatic areas each with a single stigmatic spine; (viii) anal cleft shallow; (ix) each antenna 8-segmented; (x) cup-shaped invaginations of ventral tubular ducts of two sizes; (xi) tibio-tarsal articulatory sclerosis absent; (xii) claw denticle present; and (xiii) both claw digitules slender.

Cryptes utzoni differs from C. baccatus at the following DNA sequence positions (mapped to the GenBank reference sequence listed for each gene). Dashes (-) represent deletions.

18S: Reference sequence: Cryptes baccatus (ID: LGC03026): GenBank accession number: MH844467 . Site# 156 (A), 171 (T), 252 (T), 314 (T).

28S: Reference sequence: Cryptes baccatus (ID: LGC03026): GenBank accession number: MH886629 . Site# 11 (T), 29 (G), 31–53 (TGGTCGTCGCGCTCGCGCGACGG), 55–56 (TT), 146 (C), 155 (A), 162–163 (GT), 176–193 (ACGTTTAGGCGTGCGTGG), 195 (T), 209 (A), 249 (A), 275 (G), 277–288 (TG), 280–281 (GT), 283 (A), 285 (G), 289–296 (AAAT----), 298–300 (TTA), 303–305 (CGC), 337 (C), 420 (A), 429–430 (--), 437–445 (--- ------), 4 47–450 (----), 453 (G), 456–459 (---A), 461 (A), 467 (A), 469–470 (AA), 477 (C), 485 (G), 554 (C), 572 (G), 576 (C), 598 (T), 600 (A), 604 (A), 607–608 (CT), 617 (G), 649–650 (AT), 661 (C), 677–688 (TGCTTTTCGGAG), 694–695 (CG), 701 (A).

COI: Reference sequence: Cryptes baccatus (ID: LGC03026): GenBank accession number: MH886615 . Site# 6 (T), 9 (G), 27 (T), 32 (T), 64 (T), 66 (A), 69 (C), 90 (C), 96 (G), 108 (C), 120 (A), 126 (A), 133 (A), 135 (T), 142 (A), 159 (C), 177 (T), 207 (T), 221–223 (CAA), 227 (T), 234 (G), 241–242 (AC), 245–246 (GA), 248–249 (GA), 252 (G), 257 (A), 264 (G), 273 (A), 279 (T), 282–283 (AT), 288 (C), 300 (T), 303 (T), 306 (T), 342–343 (TA), 351 (A), 355 (T), 363 (T), 366 (G), 380–381 (GG), 387–388 (AT), 390 (G), 397 (A), 399 (T), 404 (G), 408 (G), 410 (A), 412 (A), 415–417 (TAT), 420 (T), 423–426 (AAGA), 435 (C), 438 (G), 447 (T), 453 (T), 456 (A), 459 (A), 466 (G), 477 (C), 489 (A), 492 (G), 534 (G), 543 (C), 546–547 (CT), 558 (A), 573 (C), 579 (T).

EF-1α: Reference sequence: Cryptes baccatus (ID: LGC03026): GenBank accession number: MH886640 . Site# 15 (G), 66 (C), 87 (C), 102–103 (AC), 107 (G), 111 (C), 113 (C), 117–119 (TGG), 124 (T), 128 (A), 130–132 (TGT), 136–137 (AG), 143–144 (GT), 151 (C), 153 (T), 157 (A), 161 (C), 195 (C), 207 (C), 219 (T), 222 (A), 258 (C), 267 (C), 279 (C), 300 (T), 321 (G), 339 (C), 369 (G), 372 (T), 378–379 (TT), 399 (T), 408 (C), 423 (G), 426 (T), 451 (T), 455 (A), 458 (C), 463 (T), 467–470 (TTGT), 474–475 (GC), 483 (G), 486 (A), 490–491 (GT), 495 (C), 500 (A), 508–510 (TCT), 516 (C), 522 (C), 561 (T), 573 (T), 597 (T), 600 (T), 609 (T).

Description. Adult female ( Figs 4 , 1B ) (drawing and measurements based on eight specimens: LGC02307f1 to LGC02307f8, all in good condition).

Unmounted specimens. Live adult female ( Fig. 1B ) body highly convex, truncated dorsally, yellowish to light brown in colour; with a white longitudinal stripe with irregular black border that is composed of pigments (which disappear during slide-mounting processes) running longitudinally from head to area anterior to anal plates on mid dorsum ( Fig. 1 ); with some small, raised, irregularly-rounded black spots on the dorsum of unmounted specimens. Part of body margin covered by a thin layer of white wax, with ventral and upper part of body devoid of wax, at least on young females. All specimens were found on the stems of the host plant.

Slide-mounted specimens. Body of young adult female ( Fig. 4 ) circular, 2.0– 3.6 mm long, 1.5–3.4 mm wide.

Dorsum. Dorsum mostly membranous but sclerotised around anal plates on older specimens (not illustrated on Figure 4 as drawing was based on a young adult female). Dorsal setae setose and of 2 sizes: (i) shorter setae each 8–10 Μ m long, sparsely scattered throughout dorsum except absent medially from end of head to anal plates; and (ii) longer setae each 20–40 Μ m long, restricted to a broad band submedially on each side. Dorsal tubular ducts of 1 type, each with a cup-shaped invagination 5–7 Μ m wide, a broad outer ductule 25–40 Μ m long, a narrow inner ductule 13–20 Μ m long, with a well-developed terminal gland; abundant in a broad marginal to submedial band around dorsum. Dorsal pores flat, simple and ovoid, each about 3–4 Μ m in maximum dimension, scattered throughout dorsum. Dorsal microducts, dorsal tubercles and preopercular pores absent. Anal plates each half- circular, 145–165 Μ m long, 50–65 Μ m wide; with 3 setae apically on each plate plus 2 discal setae, each seta 45–55 Μ m long. Ano-genital fold probably with 2 pairs of setae on anterior margin and 5 pairs laterally. Anal ring well sclerotised, 45–50 Μ m in diameter, probably bearing 5 pairs of setae, each about 125 Μ m long (but only 1 female, LGC02307f5, could be measured).

Margin. Marginal setae setose and often with apex slightly bent, 30–55 Μ m long, arranged in a single marginal row; with 11–18 setae on head between stigmatic areas, 2–5 on each side between anterior and posterior stigmatic areas, and 10–14 on each side of abdomen; marginal setae at apex of abdomen not differentiated from others. Anal cleft present, shallow. Stigmatic cleft absent; stigmatic spines each 21–30 Μ m long with a rounded apex, some with apex slightly bent; sometimes bifurcated in anterior stigmatic area (e.g., on specimen LGC02307f7); with 2 spines in each anterior stigmatic area and with 1 in each posterior stigmatic area. No eyespots detected.

Venter. Derm entirely membranous; segmentation visible on mid-areas of thorax and abdomen. Ventral setae setose, each 10–15 µ m long, sparsely scattered across venter. Pregenital segment (VII) with a single pair of pregenital setae, each seta 23–33 Μ m long. Multilocular disc-pores each about 8 Μ m in diameter and with 8–10 loculi; abundant around genital opening, becoming progressively less frequent across preceding abdominal segments where present in irregular transverse rows, plus in submedial clusters on each abdominal and meta- and mesothoracic segments. Each stigmatic furrow with a band of spiracular disc-pores, each pore mostly with 5 loculi and about 6 Μ m in diameter, with 22–25 pores present between each spiracle and body margin. Ventral microducts each with an outer ductule 3 Μ m wide and an inner ductule that divides into 2–4 long filaments; sparsely scattered throughout venter but abundant on head between antennae and posterior to labium. Ventral tubular ducts each with a broad outer ductule 25–33 Μ m long, and a narrow inner ductule 13–15 Μ m long with a well-developed terminal gland; ducts of two types: one with a cup-shaped invagination 5–7 Μ m wide, mostly present in a broad marginal to submarginal band and sparsely present in median areas of abdomen and thorax but absent from the area immediately anterior to mouthparts; and another with a cup-shaped invagination 4–5 Μ m wide present medially on thorax, especially near mouthparts. Spiracles well developed: anterior spiracle + peritreme 102–114 Μ m long, peritreme 48–66 Μ m wide; posterior spiracle + peritreme 108–120 Μ m long, peritreme 60–66 Μ m wide. Legs well developed; each with tibio-tarsal articulation but no articulatory sclerosis; each claw 33–36 Μ m long, with a denticle; both claw digitules fine and slightly shorter than thin tarsal digitules; trochanter + femur 1 50–180 Μ m and tibia + tarsus 150–180 Μ m. Antennae each with 8 segments, total length 210–252 Μ m; scape and pedicel each with about 2 setae, segments III and IV without setae, segment V with 1 short seta and 2 longer setae, segment VI with 1 fleshy seta, segment VII with 1 fleshy and 2 setose setae, and segment VIII with a pair of fleshy setae, about 4 stiff setae and 3 setose setae. Clypeolabral shield 192–210 Μ m long, 186–210 Μ m wide. Labium 66–72 Μ m long, 90–120 Μ m wide, with 3 pairs of setae.

Etymology. The species epithet honours Danish architect Jørn Utzon, who designed the UNESCO World Heritage-Listed Sydney Opera House (Sydney, Australia) and frequently used sculptural curves in his designs. In life, the adult females of C. utzoni (Utzon's scale) and their tests invoke the curves of the arching white shells of the Sydney Opera House.

Figures

FIGURE 1. A. Cryptes utzoni sp. n. Adult females on twig of Acacia aneura (Fabaceae) from Yeo Lake Nature Reserve, Western Australia. Notice a thin layer of white wax that partially covers the insect. Photograph by L.G. Cook. B. An adult female of Austrolichtensia hakearum on the stem of Hakea pandanicarpa (Proteaceae) from Stirling Range National Park, Western Australia. Photograph by T.L. Semple. C. Cryptes baccatus. Young adult females (LGC03153) tended by an ant (Leptomyrmex sp.) on a twig of Acacia leiocalyx in Mt Moffatt section of Carnarvon Gorge National Park, QLD, Australia. Many of the smaller females have exit holes of parasitoids. Photograph by L.G. Cook.

FIGURE 4. Adult female of Cryptes utzoni Lin, Kondo & Cook sp. n. dsp: dorsal simple pore; mset: marginal seta; stgset: stigmatic seta; dtbdt: dorsal tubular duct; ldset: long dorsal seta; sdset: short dorsal seta; anplt: anal plate; mdp: multilocular disc-pores; vset: ventral seta; vmic: ventral microduct; vtbdt: ventral tubular duct; spp: spiracular disc-pore.