Lutztrema spp

Heneberg, Petr, Sitko, Jiljí, Casero, María & Rząd, Izabella, 2023, New molecular data help clarify the taxonomy of Central European avian Dicrocoeliidae Looss, 1899 (Trematoda: Plagiorchiida), International Journal for Parasitology: Parasites and Wildlife 22, pp. 276-299 : 286-297

3.1.6. Lutztrema spp

Two species of Lutztrema were identified. The first species was represented by multiple vouchers of Lu. attenuatum from T. merula and Turdus philomelos . However, an additional species was identified, here termed Lutztrema sp. n. 3, which was abundant in Sylvia atricapilla (prevalence 23.3%), with A. arundinaceus (prevalence 0.3%) serving as another less frequently parasitized host (see, e.g., Fig. 1 ).

Bayesian inference confirmed the above conclusions obtained using the maximum likelihood analyses. The resulting trees generated in MrBayes are provided in Figs. S1–S 5.

3.1.7. Descriptions and comparative data for new species

Lyperosomum sp. n. 1 – Lyperosomum tenori Sitko & Heneberg sp. n.

Description (host: Delichon urbicum , holotype and 20 paratype individuals) ( Fig. 6A , Fig. 7 , Table 3). Immature individuals with lanceolate body, widest in ventral sucker region. Adult individuals with longitudinally oval body 2000–3718 (2885 ± 499), width 400–850 (628 ± 130) at level of vitellarium, body width/length ratio 1:2.96–6.59 (4.74 ± 1.07). Forebody 212–800 (452 ± 127), hindbody 1229–2946 (2129 ± 413). Forebody/hindbody ratio in immature individuals 1:1.89–2.32, in adult individuals 1:2.82–6.93 (4.95 ± 1.12). Tegument smooth, with only few papillae. Oral sucker oval or round, subterminal,

286

166–294 (211 ± 36) × 147–322 (205 ± 44). Pharynx oval or globular, posterior to oral sucker, in some individuals extending to oral sucker region by almost half of its length, 64–138 (91 ± 20) × 83–147 (109 ± 21). Intestinal bifurcation in short distance posterior to pharynx, intestinal ceca reaching about half distance between vitelline follicles and posterior body extremity, rarely forming esophagus 41–110 (76 ± 27). Ventral sucker in first fifth of body length, conspicuously large, globular or oval, 304–506 (386 ± 52) × 222–560 (377 ± 83). Oral/ventral sucker length ratio 1:1.40–2.62 (1.86 ± 0.33), oral/ventral sucker width ratio 1:1.21–2.38 (1.81 ± 0.31). Cirrus pouch poorly developed, in many individuals not discernible, 101–276 (165 ± 40) × 40–138 (79 ± 25), extends anteriorly beyond intestinal bifurcation. Genital opening at level of posterior end of pharynx. Genital organs in anterior third of body. Testes of immature individuals much smaller than ventral sucker, in adult specimens reaching almost the same size as ventral sucker, in old individuals atrophied, globular or oval, located slightly oblique or laterally on same level, with anterior margins frequently reaching into ventral sucker region, separated in median region from one another and from ventral sucker by uterine loops. Left testis 110-248 (164 ± 38) × 138–221 (178 ± 25), right testis 104-230 (160 ± 35) × 138–221 (178 ± 25). Ovary widely oval, 116–252 (163 ± 28) × 128–296 (209 ± 45), in young individuals of similar size as testes, in adult individuals about half-larger than testes. Mehlis’ gland posterior to ovary, anterior margin rarely covered by ovary, round or oval, 92–230 (119 ± 32) × 92–166 (125 ± 22). Vitellarium lateral, consisting of large contiguous follicles, extending from posterior end of ventral sucker or half distance between ventral sucker and testes or, more rarely, from half of testes length to anterior end of posterior third of body, always of equal length. Vitelline follicles in old individuals atrophied, with only few separate follicles discernible. Longer vitelline branch 605–1857 (1156 ± 313), shorter 571–1629 (1042 ± 317). Uterus strongly developed. In adult individuals, uterine loops fill hindbody, in forebody uterine loops sometimes partly overlapping genital organs and ventral sucker. Uterus opening in genital atrium at pharynx region. In old individuals, only few eggs in forebody. Eggs operculated, their coloration variable from bright yellow to dark bronze, fully developed eggs contain miracidia, 33–48 (36 ± 2) × 21–28 (22 ± 2). Excretory vesicle I-shaped, extent not determined.

Type host: Delichon urbicum (Linnaeus, 1758) ( Aves: Hirundinidae ) (adult birds: examined 101 host individuals, prevalence 4.95%, intensity of infection 1–7 individuals).

Other hosts: Passeriformes – Acrocephalus arundinaceus (Linnaeus, 1758) ( Aves: Acrocephalidae ) (adult birds: examined 292 host individuals, prevalence 4.10%, intensity of infection 1–2 individuals), Acrocephalus scirpaceus (Hermann, 1804) ( Aves: Acrocephalidae ) (adult bird: examined 180 host individuals, prevalence 0.56%, intensity of infection 1 individual), Acrocephalus schoenobaenus (Linnaeus, 1758) ( Aves: Acrocephalidae ) (adult birds: examined 210 host individuals, prevalence 0.48%, intensity of infection 1 individual), Hirundo rustica Linnaeus, 1758 ( Aves: Hirundinidae ) (adult birds: examined 399 host individuals, prevalence 2.76%, intensity of infection 1–3 individuals).

Location in host: Gallbladder.

Type locality: Czech Republic: Z´ahlinice (49.29 ◦ N, 17.48 ◦ E) .

Other localities: Czech Republic: Pˇrerov (49.45 ◦ N, 17.46 ◦ E) .

Type specimens: Holotype P–P–1859/35A and 20 paratype specimens P–P–1859/35B, all in the collection of Comenius Museum, Pˇrerov, Czech Republic, all represent adult individuals. DNA samples are deposited at the Charles University, Third Faculty of Medicine , Prague, Czech Republic (marked as 3LF-3930).

Zoobank accession: The Life Science Identifier ( LSID) for Lyperosomum tenori sp. n. is urn:lsid:zoobank.org:act:C9162860-5167-4EDA-BF91-0C3ADCDF244A .

DNA sequences: ITS2: ON695721; 18S rDNA: ON691502; CO1: ON690060; ND1: ON687584.

Etymology: The specific epithet tenori is dedicated to prominent Czech helminthologist, Prof. Frantiˇsek Tenora (22-Sep-1930 – 22-Aug- 2011), who was a co-author of the first report of this species (Kopˇriva and Tenora, 1961).

Misidentifications: Lyperosomum collurionis (Skrjabin and Issatschikov, 1927) : Kopˇriva and Tenora (1961) in Delichon urbicum .

Remarks: Rare parasite of swallows ( Hirundo spp. ), martins ( Delichon spp. ), and reed warblers ( Acrocephalus spp. ) in Europe.

Lyperosomum tenori sp. n. differs from Ly. longicauda , Ly. clathratum , and Ly. petiolatum in body shape and body size. Lyperosomum tenori sp. n.

287

288

289

differs from Ly. oswaldoi in the body length, forebody and hindbody length, forebody/hindbody ratio, absence of spines (relevant only in well-preserved material, as the spines are often lost in all Lyperosomum spp . when the materials are not obtained from freshly dead hosts), oral and ventral suckers dimensions, ratios of oral/ventral suckers dimensions, testes and vitellaria size, and egg size ( Table 3). There are marked differences at the molecular level at all four DNA loci tested ( Figs. 1–4 , Figs. S1–S 3 , Fig. S5 ). Lyperosomum tenori sp. n. and Ly. collurionis can be distinguished, e.g., by robust differences in the ND1. Evolutionary divergence in ND1 between Ly. tenori sp. n. ON687584 and Ly. collurionis ON 687574 was 0.369 base substitutions per site).

Lyperosomum sp. n. 4 – Lyperosomum hirundinis Sitko & Heneberg sp. n.

Description (host: Hirundo rustica , holotype and 24 paratype individuals) ( Fig. 6E–F , Fig. 7 , Table 3). Adult individuals with longitudinally oval body 2571–3918 (3272 ± 365), width 314–539 (414 ± 66) at level of ventral sucker, body width/length ratio 1:5.61–10.42 (8.12 ± 1.40). Preoral space 6–23 (14 ± 5). Forebody 261–435 (364 ± 43), hindbody 2000–3003 (2531 ± 319). Tegument smooth, only with single papilla. Oral sucker oval or round, subterminal, 116–162 (143 ± 11) × 116–157 (135 ± 11). Pharynx oval or globular, posterior to oral sucker, in some individuals extending to oral sucker region by almost half of its length, 48–75 (65 ± 7) × 60–93 (77 ± 7). Intestinal bifurcation in short distance posterior to pharynx, intestinal ceca reaching about half of distance between vitelline follicles and posterior body extremity, sometimes forming esophagus 41. Ventral sucker in first sixth of body length, conspicuously large, globular or oval, 260–360 (306 ± 27) × 261–394 (319 ± 33). Oral/ventral sucker length ratio 1:1.86–2.55 (2.15 ± 0.19), oral/ventral sucker width ratio 1:1.85–2.90 (2.80 ± 0.26). Cirrus pouch poorly developed, in many individuals not discernible, 122–174 (140 ± 13) × 122–174 (140 ± 13), extends anteriorly of intestinal bifurcation into pharynx region, where it terminates by genital opening. Genital organs in anterior third of body. Testes much smaller then ventral sucker, globular or oval, tandem or diagonally, anterior margin of anterior testes reaches ventral sucker edge, often separated in median region from one another by uterine loops. Anterior testis 133- 278 (188 ± 35) × 128–261 (207 ± 32), posterior testis 145-244 (187 ± 25) × 145–273 (205 ± 37). Ovary widely oval 87–162 (126 ± 20) × 87–238 (160 ± 34). Mehlis’ gland posterior to ovary, anterior margin rarely covered by ovary, round or oval, 70–99 (80 ± 11) × 70–116 (89 ± 14). Vitellarium lateral, consisting of contiguous large follicles, extending to posterior end of anterior testes, rarely to half of testes length, of equal length or one branch slightly longer. Longer vitelline branch 1028–2029 (1393 ± 230), shorter 1028–2000 (1350 ± 205). Uterus strongly developed, uterine loops fill hindbody, in forebody uterine loops sometimes partly overlapping genital organs and ventral sucker. Uterus opening in genital atrium at pharynx region. Eggs operculated, fully developed contain miracidia, 34–36 (35 ± 0.9) × 24–26 (25 ± 1). Excretory vesicle I-shaped, its extent not determined.

Type host: Hirundo rustica Linnaeus, 1758 ( Aves: Hirundinidae ) (adult birds: examined 399 host individuals, prevalence 0.5%, intensity of infection 1–25 individuals).

Location in host: Gallbladder.

Type locality: Czech Republic: Z´ahlinice (49.29 ◦ N, 17.48 ◦ E) .

Type specimens: Holotype P–P–1859/38A and 24 paratype specimens P–P–1859/38B, all in the collection of Comenius Museum, Pˇrerov, Czech Republic, all represent adult individuals. DNA samples are deposited at the Charles University, Third Faculty of Medicine , Prague, Czech Republic (marked as 3LF-4470, 3LF-4471, and 3LF-4472).

Zoobank accession: The Life Science Identifier ( LSID) for Lyperosomum tenori sp. n. is urn:lsid:zoobank.org:act:506D1CAE-B1E4-4383-A1C3–BFC9DD30D111 .

DNA sequences: ITS2: OR405223-5; 18S rDNA: OR416890-2; CO1: OR413709-11; ND1: OR426427-9.

Etymology: The specific epithet hirundinis is derived from the genus name of the type host of this species.

Remarks: Rare parasite of swallows ( Hirundo rustica ) in Europe.

Lyperosomum hirundinis sp. n. differs from all other Lyperosomum spp . in the position of the testes. In all other species of the genus, the testes are opposite, whereas those of L. hirundinis sp. n. are in tandem, or, rarely, diagonally (when the posterior testis reaches at most up to half of the length of anterior testes). The body is long, forebody:hindbody ratio is1: 5.38–9.16 (7.2 ± 0.97) ( Table 3). There are marked differences at the molecular level in hypervariable DNA markers, such as ITS2, CO1, and ND1 ( Figs. 1–2 , Fig. 4 , Figs. S1–S 2 , Fig. S5 ).

Lyperosomum sp. n. 5 – Lyperosomum atricapillae Sitko & Heneberg sp. n.

Description (host: Sylvia atricapilla , holotype and 30 paratype specimens) ( Figs. 6B and 8 , Table 4). Body of immature individuals lanceolate, widest in ventral sucker region, adults longitudinally oval, length 3120–7350 (5827 ± 965), body widest at level of vitellarium, width 714–1486 (1132 ± 190), body width/length ratio 1:2.76–6.77 (4.47 ± 0.97). Preoral space 18–55 (38 ± 10). Forebody 629–1657 (1136 ± 212), hindbody 2343–5091 (3993 ± 605). Forebody/hindbody ratio in immature individuals 1:1.79–2.32, in adults 1:2.86–4.24 (3.58 ± 0.42). Tegument smooth, only with few papillae. Oral sucker oval or round, subterminal, 239–414 (325 ± 42) × 248–432 (347 ± 42). Pharynx oval or globular, posterior to oral sucker, in some individuals extending to oral sucker region by almost half of its length, 92–175 (129 ± 18) × 110–184 (151 ± 16). Intestinal bifurcation closely posterior to pharynx, esophagus 6–145 (42 ± 31), ceca reaching about half of distance between vitelline follicles and posterior body extremity. Ventral sucker in first fifth of body length, conspicuously large, globular or oval, 448–699 (569 ± 62) × 478–690 (572 ± 62). Oral/ventral sucker length ratio 1:1.38–2.30 (1.78 ± 0.22), oral/ventral sucker width ratio 1:1.25–2.04 (1.66 ± 0.21). Cirrus pouch poorly developed, 322–672 (511 ± 90) × 147–202 (165 ± 15), in many individuals not discernible, extends anteriorly of intestinal bifurcation. Genital opening at level of posterior end of pharynx. Genital organs in anterior third of body. Testes globular or oval, both laterally on same level, anterior margins often reaching ventral sucker region, separated in median region from one another by uterine loops. Testes in immature individuals much smaller than ventral sucker, in adult individuals almost of ventral sucker size, in old individuals atrophied. Left testis 175-350 (250 ± 37) × 156–386 (267 ± 54), right 184–377 (254 ± 44) × 184–368 (262 ± 50). Ovary 175–350 (251 ± 41) × 156–386 (267 ± 54). Mehlis’ gland posterior to ovary, round or oval, 138–233 (196 ± 34) × 166–276 (228 ± 40). Vitellarium positioned laterally, consisting of contiguous large follicles, anteriorly up to half of testes length, always of unequal length, atrophied in old individuals, with only few separated follicles discernible, longer vitelline branch 1143–3003 (1814 ± 374), shorter vitelline branch 1086–2514 (1672 ± 307). Uterus strongly developed. In adult individuals, most uterus loops in hindbody, filling the whole space; in forebody uterine loops overlap genital organs and partly ventral sucker. Uterus opening in genital atrium at pharynx region. In old individuals, only few eggs in forebody. Eggs operculated, their coloration variable from brightly yellow to dark bronze, fully developed contain miracidia, 43–53 (47 ± 2) × 26–31 (28 ± 2). Excretory vesicle I-shaped, its extent not determined.

Type host: Sylvia atricapilla (Linnaeus, 1758) ( Aves: Sylviidae ) (examined 769 host individuals, prevalence 21.72%, intensity of infection 1–26 individuals).

Other hosts: Scolopax rusticola (Linnaeus, 1758) ( Aves: Scolopacidae ) (adult birds: examined 115 host individuals, prevalence 0.97%, intensity of infection 1 individual), Dryocopus martius ( Aves: Picidae ) (9 host individuals, prevalence 11%, intensity of infection 6 individuals), Emberiza schoeniclus (Linnaeus, 1758) ( Aves: Emberizidae ) (adult birds: examined 273 host individuals, prevalence 0.37%, intensity of infection 1 individual), Sylvia borin (Boddaert, 1783) ( Aves: Sylviidae ) (adult birds: examined 58 host individuals, prevalence 1.72%, intensity of infection 1 individual).

Location in host: Liver.

290

Type locality: Czech Republic: Z´ahlinice (49.29 ◦ N, 17.48 ◦ E) .

Other localities: Czech Republic: Bartoˇsovice (49.66 ◦ N, 18.05 ◦ E) , Blansko (49.36 ◦ N, 16.64 ◦ E) , Pˇrerov (49.45 ◦ N, 17.46 ◦ E), Sedlec (48.86 ◦ N, 19.16 ◦ E) .

Type specimens: Holotype P–P–1859/32A and 300 paratype specimens P–P–1859/32B, all in the collection of Comenius Museum, Pˇrerov, Czech Republic, all represent adult individuals. DNA samples are deposited at the Charles University, Third Faculty of Medicine , Prague, Czech Republic (marked as 3LF-2738, 3LF-2745, 3LF-4229).

Zoobank accession: The LSID for Lyperosomum atricapillae sp. n. is urn:lsid:zoobank.org:act:858BAF5B–F166-4732-AA65-7C075ED746F2 .

DNA sequences: host Sylvia atricapilla : ITS2: ON695704; 18S rDNA: ON691496; CO1: ON690046; ND1: ON687572; host Emberiza schoeniclus : ITS2: ON695701; 18S rDNA: ON691494; CO1: ON690041; ND1: ON687568; host Scolopax rusticola : ITS2: ON695734; 18S rDNA: ON691511; CO1: ON690078; ND1: ON687596.

Etymology: The specific epithet atricapillae is derived as a genitive of the host species name atricapilla .

Misidentifications: Lyperosomum alectoris (Noller and Enigk, 1932) : Iskova (1977) in Sylvia atricapilla , small intestine, Cherson region,

291

Ukraine. Lyperosomum alaudae (Strom and Sondak, 1935) : Bykhovskaya-Pavlovskaya (1974) in Alauda arvensis , Corvus monedula and one of 11 examined Sylvia atricapilla . Lyperosomum collurionis (Skrjabin and Issatschikov, 1927) : Aldhoun et al. (2018) in Sylvia atricapilla ; Hildebrand et al. (2016) in Sylvia atricapilla .

Remarks: Common parasite of blackcaps ( Sylvia atricapilla ) in Europe, other less frequently parasitized hosts include unrelated bird species.

Lyperosomum atricapillae sp. n. differs from Ly. petiolatum (except Ly. petiolatum from Pa. major ) ( Fig. 9 ) and Lyperosomum turdia ( Fig. 10 ) in its shorter body width, shorter forebody, smaller ventral sucker, and smaller testes. Lyperosomum atricapillae sp. n. differs from Ly. collurionis in larger bursa cirri and from Ly. longicauda in shorter body length, shorter hindbody, lower body width/length ratio, lower forebody/ hindbody ratio, smaller ventral sucker and long oval or oval testis and ovary. Note that freeze-thaw cycles lead to alterations in body length, body width, and forebody/hindbody ratios of Ly. atricapillae sp. n. There are also marked differences at the molecular level at all four DNA loci tested ( Figs. 1–4 , Figs. S1–S 3 , Fig. S5 ). There are marked differences at the molecular level in CO1 (genetic distance 0.009 –0.015 base

292

293

substitutions per site; genetic distance within L. atricapillae sp. n. (n = 16) = 0.000 base substitutions per site; genetic distance within L. petiolatum (n = 23) = 0.000 –0.009 base substitutions per site) and ND1 (genetic distance 0.014 –0.025 base substitutions per site except for MK391421 (0.000; likely misidentified) and except for MK391425 (0.011); genetic distance within L. atricapillae sp. n. (n = 15) =

0.000 –0.003 base substitutions per site; genetic distance within L. petiolatum (n = 28) = 0.000 –0.010 base substitutions per site except for MK391421). Lyperosomum atricapillae sp. n., Ly. petiolatum , and Ly. turdia can be distinguished, e.g., by differences in the CO1 sequence T N 1 GGTCT N 2 GATGTTAAGACTGCTGTTTTTTTTAGTTC (position 152–188 in ON690046.1), where the nucleotides N 1 and N 2 are

294

represented by C and A, respectively, in Ly. atricapillae sp. n., T and G, respectively, in Ly. petiolatum , and A and C, respectively, in Ly. turdia . All ten Ly. atricapillae sp. n. individuals, which we sequenced in CO1, had identical sequences of the CO1 locus. Evolutionary divergence in CO1 between Ly. atricapillae sp. n. and Ly. petiolatum (sequences from 19 individuals) ranged between 0.009 and 0.015 base substitutions per site (with the lowest values received only for Ly. petiolatum from multiple isolates from corvids, whereas Ly. petiolatum from Parus major , Prunella modularis , and Turdus merula had the evolutionary divergence ≥0.012 base substitutions per site). Because of the low evolutionary divergence, we sequenced a large number of individuals of both species, but the two above-mentioned point mutations (and the replacement of C in Ly. atricapillae sp. n. with T in Ly. petiolatum at the position 333 of ON690046.1) were present in all the tested specimens.

Stromitrema sp. n. 2 – Stromitrema acrocephali Sitko & Heneberg sp. n.

Description (host: Acrocephalus scirpaceus , holotype specimen) ( Figs. 6D and 9 , Table 5). Body pyriform or subpyriform, attenuated posteriorly, and rounded anteriorly, broadest in testes region, 4896 × 1286. Body width/length ratio 1:3.8. Body tegument smooth. Oral sucker terminal, well developed, oval, 402 × 375. Round ventral sucker in forebody, markedly larger than oral sucker. Ventral sucker in living specimens very distinct but may be difficult to observe in stained individuals. In fixed specimen well visible in reflected light of stereomicroscope in ethanol. After transfer to xylene and Canada balsam ventral sucker becomes poorly distinguishable. Ventral sucker 522 × 522. Oral/ ventral sucker length ratio 1:1.3, oral/ventral sucker width ratio 1:1.4. Prepharynx not developed, pharynx oval, placed just posterior to oral sucker, 134 × 149. Esophagus nearly absent; ceca long, almost reach posterior body extremity. Ceca blindly ended, posterior ends overlapped by uterus loops. Testes in second third of body, at level of ventral sucker or its posterior margin, left testis oval, lobed, 283 × 179, right testis oval, 322 × 230. Male genital opening in median line of body. Bursa cirri long oval, 340 × 200. Ovary strongly lobed, medially located, posterior to ventral sucker, 368 × 460. Mehlis’ gland oval, 320 × 240. Vitellarium forms large follicles in two lateral branches, extracecal. Anterior end of vitellarium at level of posterior margins of testes, posterior end at half distance between ventral sucker and posterior body extremity. Left vitelline branch 943, right vitelline branch 857. Uterus strongly developed and fills most of body, uterus loops reach level of oral sucker posterior edge. Eggs operculated, color from yellow to dark bronze, with miracidia 35–43 × 23–35.

Type host: Acrocephalus scirpaceus (Hermann, 1804) ( Aves: Acrocephalidae ) (adult birds: examined 180 host individuals, prevalence 0.56%, intensity of infection 2 individuals).

Location in host: Gall bladder.

Type locality: Czech Republic: Z´ahlinice (49.29 ◦ N, 17.48 ◦ E) .

Type specimens: Holotype P–P–1859/ 29 in the collection of Comenius Museum, Pˇrerov, Czech Republic, represents adult individual. DNA sample is deposited at the Charles University, Third Faculty of Medicine , Prague, Czech Republic (marked as 3LF-3947).

Zoobank accession: The LSID for Stromitrema acrocephali sp. n. is urn:lsid:zoobank.org:act:BA7D5C3C–CB59–4C56–B9B3–C425CF160D67 .

DNA sequences: ITS2: MH 423413; 18S rDNA: MH 423424; CO1: ON690070; ND1: ON687588.

Etymology: The specific epithet acrocephali is derived as a genitive of the host generic name Acrocephalus .

Remarks: Rare parasite of reed warblers ( Acrocephalus spp. ) in Europe.

Stromitrema acrocephali sp. n. differs from closely related S. koshewnikowi by thinner body, smaller oral sucker, and smaller eggs ( Table 5). There are marked differences at the molecular level in CO1 (genetic distance 0.137 base substitutions per site; genetic distance within S. koshewnikowi (n = 4) = 0.000 base substitutions per site), ND1 (genetic distance 0.249 base substitutions per site; genetic distance within S. koshewnikowi (n = 4) = 0.000 base substitutions per site) and ITS2 (genetic distance 0.033 base substitutions per site; genetic distance within S. koshewnikowi (n = 4) = 0.000 base substitutions per site); informative bases were lacking only in the 18S rDNA locus ( Figs. 1–4 , Figs. S1–S 3 , Fig. S5 ). Stromitrema acrocephali sp. n. and S. koshewnikowi can be distinguished, e.g., by differences in the CO1 sequence TTAA- GAC N ACTATTTTTTTTAGTTC (position 164–188 in ON690070.1), where the nucleotide N is represented by A in S. acrocephali sp. n. and G in S. koshewnikowi .

Lutztrema sp. n. 3 – Lutztrema atricapillae Sitko & Heneberg sp. n.

Description (host: Sylvia atricapilla , holotype and 30 paratype specimens) ( Figs. 6E and 11 , Table 3). Tegument smooth, without spines, in part slightly transversely annulated. Body of adult individuals spindleshaped, strongly prolonged, slim, dorsally flattened, translucent, body length 2821–4290 (3410 ± 338), body width 197–319 (251 ± 31), body width/length ratio 1:9.84–16.98 (13.76 ± 1.91). Forebody lanceolate, forebody length 232–539 (407 ± 79), hindbody length 2286–3710 (2832 ± 404), forebody/hindbody length ratio 1:4.76–12.98 (7.22 ± 1.88). Preoral space 6–35 (18 ± 8). Body with preoral space, in which is oral sucker, continues with narrow neck with pharynx. Body strikingly

295

broadens posterior to pharynx and anterior to level of ventral sucker. Central part of body equally wide in region of gonads and vitellarium. Towards posterior body extremity, body slowly tapers off and is long. Tegument smooth, without spines, in part slightly transversely annulated. Whole body filled with uterine loops, uterus full of eggs. Immature individuals lack developed uterus and are more lanceolate, their body is widest in region of ventral sucker, posterior body extremity is short and tapered, forebody of similar length to adults. During adolescence, hindbody prolongs up to ten-times. Individuals parasitizing in gallbladder are shorter and wider than those from gall ducts, particularly hindbody is much longer in individuals from gall ducts. Intestine does not branch posterior to pharynx, continues to ventral sucker level medially, forms two or three S-shaped folds in gonadal region and another S-shaped fold in vitellarium region, rarely additional two Sshaped folds posterior to vitellarium region, terminates blind-ended immediately posterior to vitellarium region at lateral body margin, reaching or slightly overreaching posterior forebody margin. Intestine always terminates in large distance from posterior body end, length 60–793 (343 ± 175). Oral sucker small, subterminal, oval, usually longer than wider, 96–186 (127 ± 16) × 85–174 (117 ± 18). Ventral sucker in median part of body, not reaching body margins, oval, usually longer than wider, 174–278 (218 ± 24) × 168–273 (212 ± 27). Oral/ ventral sucker length ratio 1:1.09–2.40 (1.74 ± 0.26), oral/ventral sucker width ratio 1:1.20–2.40 (1.84 ± 0.27). Distance of sucker centers 641. Digestive organs in ventral part of body. Pharynx 43–70 (59 ± 8) × 46–70 (61 ± 6). Oral sucker and pharynx in tandem, partly overlap. Esophagus thin-walled, posterior to pharynx, in region of cirrus pouch passes in intestine without distinctive border. Intestine in median line up to level of anterior edge of testis. Uterus loops above ventral sucker filled in with eggs, intestine in middle of body parallel to them, further on it runs along circumference of front testis towards margin of body and zigzag among genital organs up to vitellarium. Testes in short distance posterior to ventral sucker, never reach the region of ventral sucker, few loops of uterus always separate testes and ventral sucker, slant one behind another, in individuals from bile ducts in tandem orientation, round oval or egg-shaped, never lobed. Posterior testis usually little larger than anterior one, rarely of large size difference, anterior testis 87- 319 (198 ± 56) × 99–232 (187 ± 69), posterior 99–302 (198 ± 47) × 99–244 (186 ± 34). Axis of testes slightly deflected from axis of body. Cirrus pouch oval, widened on distal end, reaches into region of ventral sucker. Cirrus pouch 104–232 (158 ± 37) × 48–87 (67 ± 12), contains several-times twisted vesicula seminal transferring into ductus ejaculator in form of small cirrus which seldom slid out. Cirrus smooth, without spines, 48–60 (54 ± 5) × 24–36 (29 ± 4). Male genital opening in median line of forebody, approximately in middle of distance between suckers. Ovary oval or round, 87–174 (121 ± 18) × 99–186 (132 ± 25), in anterior third of body, just posterior to posterior testis, always separated from testis by several uterus loops and intestine that is located diagonally to the body axis. Mehlis’ gland 36–116 (82 ± 17) × 36–116 (80 ± 17), closer to body axis than ovary. Vitellarium behind ovary or

296

Mehlis’ gland, follicles laterally, branches of unequal length, each takes ¼ to 1 / 3 of body width, front parts united, right branch 232–551 (432 ± 85), left branch 232–644 (409 ± 97). Each vitellarium branch composed of several or up to 30 large follicles, shape changes with age, follicles in immature individuals oval or egg-shaped, follicles in adults prolongated and situated perpendicularly to body axis, in old individuals, follicles degenerate, are thin and sickle-shaped. In live immature individuals, vitellarium follicles are white, in live adults creamy or yellowish, in live old individuals violet bronze or dark bronze. Bronze-colored follicles are negatively stained with carmine. Vitellarium extends towards posterior body extremity, united segment 893–1710 (1316 ± 501). Uterus very well developed, filled in with eggs, takes up whole rear part of body posterior to vitellarium. Uterus runs zigzag alongside vitellarium, reaching up to posterior body extremity, turns to front, wraps gonads and ventral sucker with its loops and empties into female genital opening above mount of cirrus pouch. Eggs with shells and opercula, 34–41 (37 ± 2) × 19–24 (23 ± 1). When infection intensity is high, some individuals do not have eggs of usual shape detectable in uterus, instead, vitellarium secrete in form of small or long clots present in uterus. Excretory system starts in hindbody, exceptionally in oral sucker region. Excretory system channels lead from dorsal part slant on ventral side, then return and run laterally up to level of anterior margin of vitellarium, where both branches unite in median line, forming elimitating channel that terminates at posterior body extremity. In adult individuals, only channels are apparent, in which excretory system runs from dorsal to ventral body part and apparent is their course between suckers. Channel in pharynx region difficult to distinguish from intestine. Parts of channel posterior to vitellarium also resemble intestine.

Type host: Sylvia atricapilla (Linnaeus, 1758) ( Aves: Sylviidae ) (examined 769 host individuals, prevalence 23.34%, intensity of infection 1–26 individuals).

Other hosts: Passeriformes – Acrocephalus arundinaceus (adult birds: examined 292 host individuals, prevalence 0.34%, intensity of infection 48 individuals), Acrocephalus schoenobaenus (adult birds: examined 210 host individuals, prevalence 0.48%, intensity of infection 7 individuals).

Location in host: Gall bladder, liver.

Type locality: Czech Republic: Z´ahlinice (49.29 ◦ N, 17.48 ◦ E) .

Another locality: Czech Republic: Bartoˇsovice (49.66 ◦ N, 18.05 ◦ E) .

Type specimens: Holotype P–P–1859/34A and 157 paratype specimens P–P–1859/34B, all in the collection of Comenius Museum, Pˇrerov, Czech Republic, all represent adult individuals. DNA samples are deposited at the Charles University, Third Faculty of Medicine , Prague, Czech Republic (marked as 3LF-2531, 3LF-2732, 3LF-2733, 3LF-3934).

Zoobank accession: The LSID for Lutztrema atricapillae sp. n. is urn:lsid:zoobank.org:act:29B2DD4D-4E9C-4464-AFEE-FBD850736454 .

DNA sequences: ITS2: MH 423400; 18S rDNA: MH 423414; 28S rDNA: ON693971; CO1: MH 423376; ND1: ON687565.

Etymology: The specific epithet atricapillae is derived as a genitive of the host species name atricapilla .

Remarks: Common parasite of blackcaps ( Sylvia atricapilla ) in Europe.

Lutztrema atricapillae sp. n. differs from closely related Lutztrema attenuatum by smaller body dimensions, smaller dimensions of all organs, particularly the ventral sucker and bursa cirri (cirrus pouch) ( Table 6). There are marked differences at the molecular level at all five DNA loci tested ( Figs. 1–4 , Figs. S1–S 3 , Fig. S5 ). Lutztrema atricapillae sp. n. and Lu. attenuatum can be distinguished, e.g., by differences in the CO1 sequence TGAGTTGTAGNNNNNNTCGTTTATG (position 248–272 in MH423378.1), where the nucleotides NNNNN are represented by TGGAAC in Lu. atricapillae sp. n. and CAGTAT in Lu. attenuatum .

Figures

Fig. 1. Maximum likelihood analysis of sequences of the CO1 DNA locus of Dicrocoeliidae. Bootstrap values (n = 1000) are indicated for nodal support. Black circles indicate new sequences. The scale-bar indicates the number of substitutions per nucleotide site.

Fig. 5. Representative photographs of slides with Brachydistomum olssoni, Brachydistomum salebrosum, and Brachydistomum ventricosum. Host species, sampling dates and host identification numbers are indicated. All specimens originated from the Czech Republic.

Fig. 3. Maximum likelihood analysis of sequences of nuclear DNA loci (28S rDNA (A) and 18S rDNA (B)) of Dicrocoeliidae. Bootstrap values (n = 1000) are indicated for nodal support. Black circles indicate new sequences. The scale-bars indicate the number of substitutions per nucleotide site.

Fig. 4. Maximum likelihood analysis of sequences of the ITS2 DNA locus of Dicrocoeliidae. Bootstrap values (n = 1000) are indicated for nodal support. Black circles indicate new sequences. The scale-bar indicates the number of substitutions per nucleotide site.

Fig. 6. Drawings of holotype specimens of Lyperosomum tenori sp. n. (A), Lyperosomum atricapillae sp. n. (B), Stromitrema acrocephali sp. n. (C), Lutztrema atricapillae sp. n. (D), and Lyperosomum hirundinis sp. n. (E–F).

Fig. 7. Representative photographs of slides with Lyperosomum tenori sp. n. (upper part of the figure) and Lyperosomum hirundinis sp. n. (lower part of the figure). Host species, sampling dates and host identification numbers are indicated. All specimens originated from the Czech Republic. Photographs of L. hirundinis sp. n. are composite photographs merged from multiple images. Note that the seeming differences in forebody shape of L. tenori sp. n. individuals is caused by differences in handling with host birds prior the fixation of the trematodes - L. tenori sp. n. from hosts that were frozen prior the examination are highly susceptible to forebody prolongation.

Fig. 2. Maximum likelihood analysis of sequences of the ND1 DNA locus of Dicrocoeliidae. Bootstrap values (n = 1000) are indicated for nodal support. Black circles indicate new sequences. The scale-bar indicates the number of substitutions per nucleotide site.

Fig. 8. Representative photographs of slides with Lyperosomum atricapillae sp. n. Host species, sampling dates and host identification numbers are indicated. All specimens originated from the Czech Republic.

Fig. 9. Representative photographs of slides with Lyperosomum petiolatum. Host species, sampling dates and host identification numbers are indicated. All specimens originated from the Czech Republic.

Fig. 10. Representative photographs of slides with Lyperosomum turdia. Host species, sampling dates and host identification numbers are indicated. All specimens originated from the Czech Republic.

Fig. 11. Representative photographs of slides with Stromitrema acrocephali sp. n. and Lutztrema atricapillae. Host species, sampling dates and host identification numbers are indicated. All specimens originated from the Czech Republic.