Akemetopon politum, Weglarz, Kathryn M. & Bartlett, Charles R., 2011

Weglarz, Kathryn M. & Bartlett, Charles R., 2011, Akemetopon, a new genus containing three new species of planthoppers (Hemiptera: Fulgoroidea: Delphacidae), Zootaxa 3007, pp. 50-60 : 54-56

Akemetopon politum sp. n.

( Figs 2 , 4 B)

Type locality. MEXICO: Durango state, rt. 40, 24 miles East El Salto.

Diagnosis. Shining chestnut brown to light brown with a white distal margin of the brachypterous forewings. Head pointed in lateral view, fastigium carinate; carinae of front concolorous with frons.

Description. COLOR: Body ( Fig. 2 A) glossy dark brown to brown, paler anteroposteriorly, females lighter, brown to nearly stramineous. Carinae of head paler than foveae, frons brown, darker medially, carinae concolorous; clypeus light brown, darker anteriorly. Subantennal carinae darker than subantennal sclerite; antennae brown proximally, paler to white distally. Pronotum, and mesonotum dark brown, scutellum paler. Vertex darker posteriorly, carinae white. Tegmina, glossy dark brown with a distal white stripe. Legs light brown, tarsi stramineous. Pygofer concolorous with body, darkening slightly mesolaterally. Parameres, segments 10 and 11 light brown.

STRUCTURE: Body. Body length (in mm) male (3) 2.11±0.28 (n=9); female (Ƥ) 2.57±0.3 (n=18); width 3 0.97±0.04 (n=5), Ƥ 1.11±0.08 (n=10). Head: Ve rt e x le ng t h 3 0.31±0.03 (n=7), Ƥ 0.35±0.03 (n=14); vertex width 3 0.30±0.01 (n=7), Ƥ 0.34±0.02 (n=14); frons length 3 0.48±0.02 (n=7), Ƥ 0.56±0.03 (n=8); frons width 3 0.40±0.03 (n=7), Ƥ 0.45±0.02 (n=8). Head narrower than pronotum. In dorsal view, vertex quadrate, apparently just longer than wide (L:W ratio 3 + Ƥ 1.03:1), rounded apically. Lateral and submedian carinae distinct, submedian carinae converging anteriorly, at or just beyond fastigium; median carinae weak. In lateral view ( Fig. 2 B), head distinctly wedge shaped, fastigium sharp, carinate; vertex extending beyond eye for 1/3rd length of eye. Frons ( Fig. 2 C) just longer than wide, lateral carinae bowed outward, reaching widest point at ventral margin of eye. Carinae of frons obscure; clypeus with carinae evident.

Thorax. Carinae of pronotum obscure, lateral carinae reaching hind margin. Median carinae of mesonotum faint. Tegmina apically rounded, diagonally truncate with a midventral notch; traces of ventation present. Calcar approximately 1/2 length of basitarsus, globular, tectiform, bearing 8–11 teeth, the ultimate tooth largest.

Abdomen. Segments of abdomen dorsomedially carinate, distal segments tapered to a truncate apex.

Genitalia. Pygofer ( Figs 2 D–F) in lateral view nearly 3 times as long ventrally as dorsad, ventral margin sinuate. In caudal view, opening rounded, approximately as tall as wide, slightly dorsoventrally compressed; margins of opening rounded. Ventral edge slightly sinuate; bearing a median ventral process, asperous at apex. Diaphragm sturdy, mildly excavate at confluence of parameres, opening to the inner chamber quadrate and rounded; armature weakly reinforced, slightly projecting, u-shaped to fit aedeagus, bearing few serrulations. Parameres forceps-like, flattened, widest in distal fourth, basal angle weak; diverging basally, converging apically, narrowed distally to avicephaliform apices, inner margins sinuate. Aedeagus downwardly curved, gradually tapering to a sharp point, round in cross section, bearing row of approximately 10 teeth equally spaced along either side; gonopore dorsal, subapical ( Fig. 4 B). Segment 10 longer than tall, armed caudally with 2 widely separated, distinctly hooked, projections. Segment 11 small, mostly held within cavity of segment 10.

Recorded hosts. Muhlenbergia sp. Schreb (muhly), Muhlenbergia vaginata Swallen (muhly).

Distribution. Mexico (Durango, Zacatecas, Mexico).

COI sequence. 5’ – GAAGTTTACATCTTAATTTTACCAGGATTTGGATTAATTTCACAT

ATTATTATACAAGAAAGAGGGAAAAAAGAAACATTTGGATCAATTGGAATAATCTACGCCATAATT GCAATCGGAATTTTAGGGTTTATTGTTTGAGCCCACCATATATTCACAGTTGGTATAGATATCGATACAC GAGCATACTTTACATCAGCAACTATAATTATTGCAGTACCCACTGGTATCAAAATTTTTAGATGAATAGC TACAATTTATGGATCTAAAATTATTTATTCACCTCAAATAATTTGATCCATGGGATTCATTTTACTTTTTAC TATTGGGGGTTTAACAGGAGTTATATTAGCAAATTCATCCATTGATATTATTTTACATGATACATATTATGT AGTTGCACATTTCCATTATGTACTTTCTATAGGTGCAGTTTTTACTATTATTGCAAGTTTTATTCATTGAT ACCCGTTATTTACGGGACTTTA – 3’

Genbank accession #: JN19147

Etymology. The specific name comes from the participle (“ politus ”) of the Latin verb “ polio ”, meaning to polish or make smooth, with the neutral ending “ -um ”.

Remarks. This species can be distinguished from A. ainigma by the angled fastigium, and from A. inornatum by the presence of a pale band at the distal margin of the tegmina and the concolorous carinae of the frons. The type series was vacuumed from Muhlenbergia vaginata . The type locality is the same as that of Frameus prolatus Bartlett, 2010 ( Delphacidae : Stenocraninae ), which was stated as N 24° 15’ 25”, W 104° 25’ 47” in Bartlett (2010).

Material examined. Holotype 3 (brachypterous) [ INHS], “ MEXICO: Durango, rt.40 / 24mi E El Salto 2400m / 26–X–1994 CH Dietrich // [red paper] HOLOTYPE / Akemetopon politum / Weglarz & Bartlett”.

Paratypes: MEXICO: Durango, same data as holotype (93, 16Ƥ, INHS); Zacatecas, Rio Frio, June 5 1983, CW & L O’Brien and Marshall (2Ƥ, 1 imm., LBOB); Mexico, LaMirasol, 7km SW. Santiago de Tianguistengo, 2800m, XI–2–1973, CW O’Brien (13, 1Ƥ, LBOB); Mexico, rt. 1500, km 64, 33 km E Ixtapaluca, 8 November 2001, CH Dietrich. vacuum (23, 1Ƥ, UDCC).

Figures

FIGURE 2. Features of Akemetopon politum sp. n. (paratype, scale = 0.2 mm). A. Dorsal habitus; B. Lateral habitus; C. Frons; D. Male pygofer, lateral view; E. Male pygofer, caudal view; F. Male pygofer, ventral view.

FIGURE 4. The aedeagus of Akemetopon species. A. A. inornatum sp. n.; B. A. politum sp. n.; C. A. ainigma sp. n.