Cordyligaster capellii Fleming & Wood, 2014

Fleming, AJ, Wood, D Monty, Smith, M Alex, Janzen, Daniel & Hallwachs, Winnie, 2014, A new species of Cordyligaster Macquart, reared from caterpillars in Area de Conservacion Guanacaste, northwestern Costa Rica, Biodiversity Data Journal 2, pp. 4174-4174 : 4174

Cordyligaster capellii Fleming & Wood, 2014 sp. n.

Materials

Type status: Holotype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0006938 ; recordedBy: D.H. Janzen & W. Hallwachs, Manuel Rios; individualID: DHJPAR0006938; individualCount: 1; sex: male; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 06-SRNP-30780,ASTAV180-06; Taxon: scientificName: Cordyligaster capelli; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: capelli; scientificNameAuthorship: Fleming & Wood; Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Guanacaste; county: Sector Pitilla; locality: Area de Conservacion Guanacaste ; verbatimLocality: Amonias; verbatimElevation: 390; verbatimLatitude: 11.04249; verbatimLongitude: -85.40339; verbatimCoordinateSystem: Decimal; decimalLatitude: 11.04249; decimalLongitude: -85.40339; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 20-Feb-2006; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen

Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0006939 ; recordedBy: D.H. Janzen & W. Hallwachs, Manuel Rios; individualID: DHJPAR0006939; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 06-SRNP-30016,ASTAV181-06; Taxon: scientificName: Cordyligaster capelli; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: capelli; scientificNameAuthorship: Fleming & Wood; Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Guanacaste; county: Sector Pitilla; locality: Area de Conservacion Guanacaste ; verbatimLocality: Pasmopa; verbatimElevation: 440; verbatimLatitude: 11.019; verbatimLongitude: -85.41; verbatimCoordinateSystem: Decimal; decimalLatitude: 11.019; decimalLongitude: -85.41; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 23-Jan-2006; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen

Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0006940 ; recordedBy: D.H. Janzen & W. Hallwachs, Manuel Rios; individualID: DHJPAR0006940; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 06-SRNP-30179,ASTAV182-06; Taxon: scientificName: Cordyligaster capelli; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: capelli; scientificNameAuthorship: Fleming & Wood; Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Guanacaste; county: Sector Pitilla; locality: Area de Conservacion Guanacaste ; verbatimLocality: Pasmopa; verbatimElevation: 440; verbatimLatitude: 11.019; verbatimLongitude: -85.41; verbatimCoordinateSystem: Decimal; decimalLatitude: 11.019; decimalLongitude: -85.41; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 02-Feb-2006; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen

Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0006941 ; recordedBy: D.H. Janzen & W. Hallwachs, Manuel Rios; individualID: DHJPAR0006941; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 06-SRNP-30178,ASTAV183-06; Taxon: scientificName: Cordyligaster capelli; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: capelli; scientificNameAuthorship: Fleming & Wood; Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Guanacaste; county: Sector Pitilla; locality: Area de Conservacion Guanacaste ; verbatimLocality: Pasmopa; verbatimElevation: 440; verbatimLatitude: 11.019; verbatimLongitude: -85.41; verbatimCoordinateSystem: Decimal; decimalLatitude: 11.019; decimalLongitude: -85.41; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 29-Jan-2006; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen

Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0006942 ; recordedBy: D.H. Janzen & W. Hallwachs, Manuel Rios; individualID: DHJPAR0006942; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 06-SRNP-30172,ASTAV184-06; Taxon: scientificName: Cordyligaster capelli; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: capelli; scientificNameAuthorship: Fleming & Wood; Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Guanacaste; county: Sector Pitilla; locality: Area de Conservacion Guanacaste ; verbatimLocality: Pasmopa; verbatimElevation: 440; verbatimLatitude: 11.019; verbatimLongitude: -85.41; verbatimCoordinateSystem: Decimal; decimalLatitude: 11.019; decimalLongitude: -85.41; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 29-Jan-2006; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen

Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0006943 ; recordedBy: D.H. Janzen & W. Hallwachs, Manuel Rios; individualID: DHJPAR0006943; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 06-SRNP-30171,ASTAV185-06; Taxon: scientificName: Cordyligaster capelli; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: capelli; scientificNameAuthorship: Fleming & Wood; Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Guanacaste; county: Sector Pitilla; locality: Area de Conservacion Guanacaste ; verbatimLocality: Pasmopa; verbatimElevation: 440; verbatimLatitude: 11.019; verbatimLongitude: -85.41; verbatimCoordinateSystem: Decimal; decimalLatitude: 11.019; decimalLongitude: -85.41; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 30-Jan-2006; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen

Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0006944 ; recordedBy: D.H. Janzen & W. Hallwachs, Petrona Rios; individualID: DHJPAR0006944; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 06-SRNP-30863,ASTAV186-06; Taxon: scientificName: Cordyligaster capelli; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: capelli; scientificNameAuthorship: Fleming & Wood; Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Guanacaste; county: Sector Pitilla; locality: Area de Conservacion Guanacaste ; verbatimLocality: Pasmopa; verbatimElevation: 440; verbatimLatitude: 11.019; verbatimLongitude: -85.41; verbatimCoordinateSystem: Decimal; decimalLatitude: 11.019; decimalLongitude: -85.41; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 28-Feb-2006; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen

Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0006945 ; recordedBy: D.H. Janzen & W. Hallwachs, Manuel Rios; individualID: DHJPAR0006945; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 06-SRNP-30168,ASTAV187-06; Taxon: scientificName: Cordyligaster capelli; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: capelli; scientificNameAuthorship: Fleming & Wood; Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Guanacaste; county: Sector Pitilla; locality: Area de Conservacion Guanacaste ; verbatimLocality: Pasmopa; verbatimElevation: 440; verbatimLatitude: 11.019; verbatimLongitude: -85.41; verbatimCoordinateSystem: Decimal; decimalLatitude: 11.019; decimalLongitude: -85.41; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 30-Jan-2006; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen

Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0006946 ; recordedBy: D.H. Janzen & W. Hallwachs, Manuel Rios; individualID: DHJPAR0006946; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 06-SRNP-30017,ASTAV188-06; Taxon: scientificName: Cordyligaster capelli; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: capelli; scientificNameAuthorship: Fleming & Wood; Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Guanacaste; county: Sector Pitilla; locality: Area de Conservacion Guanacaste ; verbatimLocality: Pasmopa; verbatimElevation: 440; verbatimLatitude: 11.019; verbatimLongitude: -85.41; verbatimCoordinateSystem: Decimal; decimalLatitude: 11.019; decimalLongitude: -85.41; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 28-Jan-2006; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen

Type status: Paratype. Occurrence: occurrenceDetails: http://janzen.sas.upenn.edu; catalogNumber: DHJPAR0055082 ; recordedBy: D.H. Janzen & W. Hallwachs, Keiner Aragon; individualID: DHJPAR0055082; individualCount: 1; lifeStage: adult; preparations: pinned; otherCatalogNumbers: 14-SRNP-45262,ASHYH1629-14; Taxon: scientificName: Cordyligaster capelli; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tachinidae; genus: Cordyligaster; specificEpithet: capelli; scientificNameAuthorship: Fleming & Wood; Location: continent: Central America; country: Costa Rica; countryCode: CR; stateProvince: Alajuela; county: Sector Rincon Rain Forest; locality: Area de Conservacion Guanacaste ; verbatimLocality: Palomo; verbatimElevation: 96; verbatimLatitude: 10.962; verbatimLongitude: -85.28; verbatimCoordinateSystem: Decimal; decimalLatitude: 10.962; decimalLongitude: -85.28; Identification: identifiedBy: AJ Fleming; dateIdentified: 2014; Event: samplingProtocol: Host Collection; verbatimEventDate: 18-Feb-2014; Record Level: language: en; institutionCode: CNC; collectionCode: Insects; basisOfRecord: Pinned Specimen

Description

Male (Fig. 1); Head: fronto orbital plate with silver tomentosity; parafacial silver; pedicel black; antenna black with plumose arista; trichiae at base, 6 times as long as base of arista is wide tapering to half that length before apex; eye bare; ocellar bristles parallel and proclinate approximately twice the length of the ocellar triangle; fronto-orbital plate narrowing at apex enclosing only the ocellar triangle; proclinate orbital bristles absent in male; palpus black. Thorax: at first glance appears glabrous black, but under certain angles of light a very light tomentum is often apparent however no vittae are visible. Three post-sutural supra alar bristles, (two strong anterior, and third one weak; second bristle strongest, 1.5X thickness of first post sutural supra alar bristles) (Fig. 3), apical scutellar bristles long, up to 3/4 length of subapical scutellars; subapical scutellar bristles parallel or divergent (forming a wide V); katepisternum bearing 2 bristles, very lightly tomentose (same as dorsum), lacking the tomentose bands apparent in C. petiolata . Wing: smoky yellow, dark amber towards base; vein R1 haired, vein R4+5 haired up to crossvein r-m (Fig. 4b); crossvein dm-cu straight not undulated; calypteres enlarged and translucent. Legs: black. Abdomen: petiolate with both discal bristles and median marginal bristles present on T1+2, T3, T4 and T5. Silver pollinosity on upper margins of abdominal segments T3, and T4. Very light tomentosity present on T5 but as in the case of the thorax, only visible under certain angles of light. Terminalia: surstylus equilaterally oblong shaped, apically bare, bearing many stout bristles posterodorsally, tip with strong inwardly apical curve when viewed dorsally. Cercus sharply pointed, ventral surface bare, separation between cerci narrow, up to 85% as long as surstylus. Dorsal surface of sternite 5 bearing two long bristles.

Female (Fig. 2); Head: fronto orbital plate with silver tomentosity except along facial ridge which appears red; pedicel black; antenna black with plumose arista; trichiae at base, 6 times as long as base of arista is wide tapering to half that length before apex; eye bare; ocellar bristles parallel and proclinate approximately twice the length of the ocellar triangle; fronto-orbital plate narrowing at apex enclosing only the ocellar triangle; 2 proclinate orbital bristles present; palpus black, with distinctive gold tomentosity on tip. Thorax: at first glance appears glabrous black, however under certain angles of light a very light tomentum is apparent. Three post-sutural supra alar bristles, (two strong anterior, and third one weak); second bristle strongest, 1.5X thickness of first post-sutural supra alar; apical scutellar bristles long, equal in length of subapical scutellars; scutellar bristles divergent (forming a wide V); katepisternum bearing 2 bristles, very lightly tomentose (equal to dorsum), lacking the tomentose bands when viewed laterally that are apparent in C. petiolata . Wing: smoky yellow, dark amber towards base; vein R1 haired, vein R4+5 haired along ¾ of its length; crossvein dm-cu straight not undulated; calypteres enlarged and translucent. Legs: black. Abdomen: petiolate with both discal bristles and median marginal bristles present on T1+2, T3, T4 and T5. Silver pollinosity on upper margins of abdominal segments T3, and T4. Very light tomentosity present on T5 but as in the case of the thorax, this is only visible under certain angles of light.

Diagnosis

Cordyligaster capellii posesses exceptionally large calypteres, a trait also shared by C. nyomala , and C. minuscula . While C. minuscula (Wulp) can also sometimes have the variable character of 3 post-sutural supra alars, C. capellii is distinguished by the presence of 3 postsutural supra-alars (Fig. 3b), smoky yellow wings (Fig. 4), and a black antennal pedicel and black palpi. C. minuscula possesses a orange brown pedicel, and reddish brown palpi. A very light tomentum covers much of the thorax as well as T5, but this trait is visible only under certain angles of light. C. minuscula also possesses only the posterior katepisternal bristle, while C. capellii has two. The holotype specimen has the DNA barcode given below:

ACTTTATATTTTATTTTTGGAGCATGAGCAGGTATATTAGGAACATCTTTAAGTATTTTAATTCGAACAGAATTAGGACATCCTGGTTCATTAATTGGAGATGATCAAATTTATAATGTTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCACCAGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGACTTCTTCCTCCTTCTTTAATATTATTATTAGTTGGTAGAATAGTTGAAAATGGAGCTGGAACAGGATGAACTGTTTACCCTCCTTTATCTTCTAATATTGCTCATAGAGGATCTTCTGTAGATTTAACTATTTTTTCATTACATTTAGCAGGAATTTCTTCTATTATAGGAGCTGTAAATTTTATTACAACAGTAATTAATATACGAGCAACAGGAATTACATTTGATCGAATACCTTTATTTGTATGATCTGTAGCTATTACAGCTTTATTACTTTTATTATCATTACCTGTATTAGCCGGAGCTATTACTATATTATTAACAGATCGAAATATAAATACTTCATTTTTTGATCCTGCAGGAGGAGGAGATCCTATTTTATATCAACACTTATTT.

Genetic comparison to the type specimens of previously know species was outside the scope of this paper, however the authors have selected to give the barcode data here as a diagnostic character such that it is readily available for future works which may undertake the barcoding of those previously described types.

Etymology

This species is named to honor Sr. Luciano Capelli of San Jose, Costa Rica in recognition and appreciation of his enthusiastic and superb photography of all aspects of ACG specifically, and Costa Rica’s conserved wildlands more broadly, and for allowing ACG and Costa Rican conservation in general to freely use these photographs to explain conserved wildlands to the public.

Distribution

Costa Rica, ACG, Prov. Guanacaste, rain forest, 390 - 440m m elevation.

Ecology

Hosts: Crambidae , Syngamia florella (Stoll, 1781). While more than 500 species of Crambidae have been reared from more than 65,000 leaf-rolling crambid caterpillars in ACG dry forest, rain forest and cloud forest (and intergrades among them), generating 3,000+ tachinid rearings, Cordyligaster capellii has been reared just 10 times and always from the leaf roller Syngamia florella feeding on Spermacoce exilis (L.O. Williams) ( Rubiaceae ) herbs in the dry-rain forest ecotone on the northern intermediate elevation slopes of Volcan Orosi and Cerro Orosilito, Sector Del Oro and Sector Pitilla, of ACG. These ten rearings were spread among 144 S. florella wild-caught caterpillars. It is likely to be the only species of host for this fly in ACG.