Symmerista minaei Chacon
publication ID |
https://dx.doi.org/10.3897/zookeys.421.6342 |
publication LSID |
lsid:zoobank.org:pub:748B0457-9F84-43E5-A165-C2CE1A36CE58 |
persistent identifier |
https://treatment.plazi.org/id/71A2F18E-A8EC-4BF6-9991-ACEC39D20799 |
taxon LSID |
lsid:zoobank.org:act:71A2F18E-A8EC-4BF6-9991-ACEC39D20799 |
treatment provided by |
|
scientific name |
Symmerista minaei Chacon |
status |
sp. n. |
Taxon classification Animalia Lepidoptera Notodontidae
Symmerista minaei Chacon View in CoL sp. n. Figs 17-25
Material examined.
4 specimens (1 male, 3 females)
Type material.
Holotype female: INB0003339208 (dissected, COI barcoded), Costa Rica, Prov. Cartago, El Guarco, Macizo de la Muerte, Estacion La Esperanza, 9.68677-83.87775, 2600 m, July 2001, R. Delgado (INBio). Paratypes: Female: INB0003155283 (COI barcoded), Costa Rica, Prov. Limon, Bratsi, Valle del Silencio, 9.107197-82.961749, 2472 m, 11-12 October 2000, R. Delgado (INBio). Female: INB0003352700 (COI barcoded), Costa Rica, Prov. Cartago, Reserva Forestal Rio Macho, El Guarco, Macizo de la Muerte, Sector La Esperanza, 9.686771-83.87775, 2600 m, August 2001, R. Delgado (INBio).
Other material examined: 1 Male, INB00033387642 (dissected) Costa Rica, Prov. Cartago, Reserva Forestal Rio Macho, El Guarco, Macizo de la Muerte, 9.68677-83.87775, 2600 m, October 2001. R. Delgado (INBio).
Etymology.
This species is dedicated to the Ministerio del Ambiente y Energía (MINAE) of the government of Costa Rica in recognition of its 28 years of continuous and widespread support for the survival and conservation of the wild biodiversity of Costa Rica.
Diagnosis.
Symmerista minaei differs from Symmerista luisdiegogomezi on: dorsal FW ground color beige and light brown, square mark creamy near the reniform spot; beige mark in the apex; fringe beige yellow; dorsal HW beige. Male genitalia: T8 anterior margin slightly concave, posterior margin finely serrated with a window in the center; St8 lateral margins wide at the base, narrow to posterior margin, anterior margin concave, slightly sclerotized with a short projection in the center, posterior margin with robust projections, highly sclerotized on each side, with blunt apices, a little dome in the middle of the posterior margin; length of the phallus 3.3 mm, proximal part of phallus tube wide at base, distal part of phallus tube robust, sclerotized, with a tubular lateral projection rounded apex with the distal nipple; proximal part of the vesica with a ventral scobinate patch, distal part of the vesica bulbous. Female genitalia: Anterior and posterior apophyses the same size, long an slender; DB sclerotized; CB rounded, membranous and pleated; posterior margin of postvaginal plate sclerotized, slightly irregular, inverted V-shape.
Description.
Male (Figs 17, 18, 21-24). Head - Antenna bipectinate, dark brown, six terminal flagellomeres with very short rami, antennal shaft brown dorsally and light brown ventrally; scape bearing a long tuft of beige scales, sensilla beige; eye smooth, round, black; frons mostly dark brown and black with beige scales; labial palpus porrect, dark brown ventrally, light brown dorsally; vertex beige with black scales; patagium dark brown and light brown.
Thorax and abdomen - Tegula dark brown at base, a mix of dark brown and light brown scales distally; mesoscutellum beige and dark brown; thoracic pleuron from beige to dark brown; dorsal area of metathorax with black and dark brown hair-like scales; legs mostly dark brown with beige scales between segments; abdominal dorsum dirty beige, venter beige. Wings - dorsal FW ground color beige and light brown, with reniform spot black; basal band light brown; postmedial band light brown; a creamy-white square distal to reniform spot; AD black; fringe dark brown with beige scales where veins touch termen; beige mark in apex; dorsal HW beige; fringe beige-yellow (Figs 17, 18) (WL 17.20-19.21 mm). Male genitalia (Figs 21-24) - T8 wider than long, anterior margin slightly concave, posterior margin finely serrated with a window in center; St8 lateral margins wide at base, narrow to posterior margins, anterior margin convex, slightly sclerotized with a short projection in center, posterior margin concave with a pair of short projections, these sclerotized with blunt apices, a small setose dome in middle of posterior margin (Fig. 23); valva membranous, mildly pubescent, margin of sacculus slightly serrated, costa with straight margin with a distal protuberance close to apex; valva with a triangular spine-like process; tegumen narrowed dorsally; uncus plate slightly concave, somewhat helmet shaped, dorsal surface rough, pubescent, ventral surface smooth with sparse pubescence, socii long, wide, pubescent at bases, narrow and flattened at apex, form s-shaped; vinculum slightly sclerotized (Figs 21, 22); length of phallus 3.3 mm, proximal part of phallus tube wide at base, distal part of phallus tube robust, sclerotized, with a tubular lateral projection rounded apex with distal nipple; proximal part of vesica with a ventral scobinate patch, distal part of vesica bulbous (Fig. 24). Female (Figs 19, 20, 25) Head - Antenna simple, shaft dark brown with cream-colored scales, scape with a tuft of cream-colored scales; eyes naked; frons dark brown, vertex dark brown with groups of beige scales at base and between antennal bases; haustellum vestigial, labial palpus dark brown.
Thorax and abdomen - Generally dark brown, tegula beige, scales of thorax long and forked. Patagium and prothorax with beige and cream scales; mesothorax with scales cream, dark brown and beige; metathorax with a group of black hair-like scales along posterior margin; abdomen light brownish gray, abdominal apex with a thick group of beige scales.
Wings - dorsally FW ground color dark brown; antemedial beige band lined at both sides by sinuous dirty dark brown lines; reniform spot black; an irregular thin white to beige line extends from the apex to the reniform spot; postmedial line beige, lined on each side with dark brown; adterminal line black; light beige area between adterminal line and postmedial band from M3 to tornus; fringe dark brown with beige scales where veins touch termen; dorsal HW dirty beige, fringe beige (Figs 19, 20) (WL 19.63-21.18 mm). Female genitalia (Fig. 25) - Papillae anales mambranous with short, scattered setae with longer, inwardly-curved setae arising from base. Anterior and posterior apophyses of same size, long and slender; DB sclerotized; CB rounded, membranous and pleated; posterior margin of postvaginal plate sclerotized, slightly irregular, inverted V-shape.
Distribution and habitat.
Symmerista minaei has only been collected at elevations between 2400 and 2600 m in highland cloud forests of the Cordillera de Talamanca (Talamanca Mountain Range) (Fig. 49).
Remarks.
DNA barcode paratype female INB0003155283.
MHMXP006-08 | INB0003155283 | Symmerista minaei | COI-5P:
AACATTATATTTCATTTTTGGAATTTGAGCAGGTATAGTTGGAACTTCATAAGCCTATTAATTCGAGCTGAATTAGGAAATCCCGGATCCCTTATTGGAGATGATCAAATTTATAACACAATTGTTACAGCCCATGCCTT TATTATAATTTTTTTTATAGTAATACCTATTATAATTGGGGGATTTGGTAATTGATTAGTCCCCCTTATGCTAGGAGCCCCAGATATAGCATTCCCACGTATAAATAATATAAGTTTTTGACTTTTACCCCCCTCCTTAACCCTTTTAATTTCAAGAAGAATCGTCGAAAATGGGGCAGGAACCGGATGGACAGTGTACCCCCCACTATCCTCCAATATTGCCCACAGTGGAAGTTCTGTAGATTTAGCTATTTTTTCCCTACATTTAGCTGGAATTTCATCAATTTTAGGGGCCATTAATTTTATCACAACAATTATTAATATACGTCTCAATAACATATCTTTTGATCAAATACCCTTATTTGTTTGAGCTGTTGGAATTACAGCATTTTTACTTTTACTTTCTTTACCTGTTCTAGGGAGCTATTACAATACTACTAACGGATCGTAATTTAAATACATCTTTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
SubFamily |
Nystaleinae |
Genus |