Choreborogas jesseausubeli Sharkey, 2021
publication ID |
https://dx.doi.org/10.3897/zookeys.1075.72197 |
publication LSID |
lsid:zoobank.org:pub:3202711B-0DEF-4B4D-95A5-36FF1D233FA4 |
persistent identifier |
https://treatment.plazi.org/id/20C776D0-74D9-4B3D-B0E0-EE4E117B28CB |
taxon LSID |
lsid:zoobank.org:act:20C776D0-74D9-4B3D-B0E0-EE4E117B28CB |
treatment provided by |
|
scientific name |
Choreborogas jesseausubeli Sharkey |
status |
sp. nov. |
? Choreborogas jesseausubeli Sharkey sp. nov.
Diagnostics.
Figure 34 View Figure 34 .
BOLD data.
BIN: BOLD:AAM5951; nearest neighbor: Choreborogas sp. BOLD:ACG8400; distance to nearest neighbor is 2.71%. Consensus barcode:
AGTATTGTATTTTTTTTTTGGTATATGATCAGGTATATTGGGYTTATCAATAAGGTTAATTATTCGGTTTGAATTAGGGGTTCCTGGATCATTTTTAGGTAATGATCAGATTTATAATAGAATTGTTACGGCYCATGCCTTGGTTATAATTTTTTTTATGGTTATACCTGTAATAATTGGGGGATTTGGTAATTGATTAATTCCTTTAATATTAGGRGCACCTGATATAGCTTTYCCTCGAATAAATAATATAAGATTTTGGTTATTAATTCCTTCTATTTTGTTATTGTTAGTTAGATCTTTAGTTAATGTTGGGGYAGGTACAGGATGAACAATTTATCCTCCTTTATCTTCRTTAATAGGTCATGGSGGGATTTCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGTGCATCATCAATTATAGGTGCAATTAATTTTATTTCTACAATTTTTAATATAAATTTATTTTCAATGAAAATAGATCAAATTATATTATTAGTTTGATCTGTATTAATCACTGCTTTTTTATTATTATTATCATTRCCTGTTTTGGCGGGGGCAATTACTATATTATTATTTGATCGTAAYATTAATAGAACTTTTTTTGATTTTTCAGGGGGAGGGGATCCTATTTTATTYCAGCATTTATT
Morphological data.
This species can be morphologically distinguished from its nearest neighbor by its swollen hind basitarsus (Fig. 34 View Figure 34 ), which is much narrower in the nearest neighbor. Males lack the swollen hind femora.
Holotype?: Costa Rica: Guanacaste, Area de Conservación Guanacaste, Sector Pailas Dos, PL12-6, 853 m, 10.7637 -85.3331, 04/xii/2014, Malaise trap, depository CNC, holotype voucher code: BIOUG46391-F12, GenBank accession: MW627542.
Paratype.
Malaise trapped, BIOUG46544-F12, BIOUG49790-H06, BIOUG07453-F05, BIOUG28810-A07, BIOUG29020-B09.
Other material: BMNHE897774 from Belize is in the same BIN and likely conspecific. There is no image on BOLD and the specimen was not examined.
Etymology.
Choreborogas jesseausubeli is named in honor of Jesse Ausubel of Rockerfeller University, New York, USA, for his very strong support of the germination and early development of DNA barcoding as an identification tool.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
SubFamily |
Rogadinae |
Genus |