Hoforsa rebekkae Tedersoo, 2024

Tedersoo, Leho, Magurno, Franco, Alkahtani, Saad & Mikryukov, Vladimir, 2024, Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes), MycoKeys 107, pp. 249-271 : 249-271

Hoforsa rebekkae Tedersoo sp. nov.

Diagnosis.

Separation from other species of Hoforsa based on the ITS region (ITS 2 positions 108–127 ggratcycccgaggtgtgaaac; one mismatch allowed) and LSU (positions 546–565 ctcctggtgctctcacccgt; no mismatch allowed) as indicated in Fig. 4 .

Type.

Soil eDNA sample: TUE 128830 (holotype); eDNA sequence EUK 1100001 (lectotype); Pinus sylvestris forest near Hofors , Sweden (60.49 ° N, 16.30 ° E) .

Description.

Other sequences: EUK 1104560 (type locality); OU 004104 (San Francisco, Ecuador, root sample); and KP 889387 and KP 889486 (both coniferous forest soil in British Columbia, Canada).

Etymology.

Hofors (Swedish) refers to type locality; and Rebekka (Scotch) refers to the first name Rebekka Artz who was the first to collect materials from this genus.

Notes.

Found from three sites across three continents, with ITS sequences differing up to 3.5 % and LSU sequences up to 0.5 %.

Figures

Figure 4. Diagnostic barcodes for Hoforsa rebekkae relative to closely-related taxa in ITS 2 and LSU.