Terebellides lavesquei, Barroso & Moreira & Capa & Nygren & Parapar, 2022

Barroso, Maria, Moreira, Juan, Capa, Maria, Nygren, Arne & Parapar, Julio, 2022, A further step towards the characterisation of Terebellides (Annelida, Trichobranchidae) diversity in the Northeast Atlantic, with the description of a new species, ZooKeys 1132, pp. 85-126 : 85

publication ID	https://dx.doi.org/10.3897/zookeys.1132.91244
publication LSID	lsid:zoobank.org:pub:4168C32E-37A7-4912-A909-4912E69030AA
persistent identifier	https://treatment.plazi.org/id/2D993190-50A3-42C0-B11E-508EA59276B6
taxon LSID	lsid:zoobank.org:act:2D993190-50A3-42C0-B11E-508EA59276B6
treatment provided by	ZooKeys by Pensoft
scientific name	Terebellides lavesquei
status	sp. nov.

Treatment

Terebellides lavesquei sp. nov.

Figs 2C View Figure 2 , 3B View Figure 3 , 4B View Figure 4 , 6 View Figure 6 , 7 View Figure 7 , 9 View Figure 9 , 10B View Figure 10 , 11 View Figure 11 , 12 View Figure 12

Terebellides lavesquei Species 5 - Nygren et al. 2018: 18-22, figs 6, 10.

Material examined.

Type material. Holotype: ZMBN116322. Paratypes (16 specimens): Skagerrak ( GNM15112 View Materials ); Norwegian coast (NTNU-VM61386, NTNU-VM61387, NTNU-VM68252, ZMBN116319, ZMBN116320, ZMBN116321, ZMBN116323, ZMBN116324, ZMBN116325, ZMBN116326, ZMBN116327, ZMBN116328, ZMBN116329, ZMBN116330, ZMBN116331, ZMBN116332) .

Holotype.

Complete specimen, 34.0 mm long and 2.0 mm wide (Fig. 4B View Figure 4 ); female with oocytes in body cavity.

GenBank accession numbers of material examined (COI).

MG025054, MG025055, MG025056, MG025057, MG025058, MG025059, MG025060, MG025061, MG025062, MG025063, MG025064, MG025065, MG025066, MG025067, MG025068, MG025069, MG025070 .

Diagnostic features of type material.

Complete individuals ranging from 5.0-35.0 mm in length (Fig. 9 View Figure 9 ). Branchial dorsal lobes lamellae provided with well-developed papillary projections and branchial ventral lobes provided with long filaments, ranging from 125.0-250.0 µm in length (Fig. 6A View Figure 6 ). Between 17-42 lamellae on dorsal lobes (Fig. 6A, B View Figure 6 ). Ciliary rows present on lamellae inner face (Fig. 6B, C View Figure 6 ). Ventral branchial lobes hidden in between dorsal ones but sometimes discernible below (Fig. 3B View Figure 3 ). Lateral lappets present on T C1-4; dorsal projection of thoracic notopodia on TC 2-4 (Fig. 3B View Figure 3 ). Geniculate chaetae in TC 5, acutely bent, with well-defined capitium (Fig. 7A View Figure 7 ). Ciliated papilla dorsal to thoracic notopodia not observed. From TC 7, neuropodia with one or two rows of type 3 thoracic uncini per torus, with rostrum/capitium length ratio of ~ 2:1 and capitium with a first row of four or five medium-sized teeth, followed by several smaller teeth (Fig. 7B, C View Figure 7 ). Abdomen with 30-31 pairs of neuropodia with type 2 uncini (Fig. 7D View Figure 7 ). Copepods observed attached to body dorsal surface in one specimen (Fig. 6D, E View Figure 6 ).

Colour pattern.

MG staining pattern characterised by compact green colourant in SG 1-6, J-shaped glandular region in SG 3-5 and striped pattern in SG 7-14 (Fig. 12 View Figure 12 ). Similar to pattern 9.

Nucleotide diagnostic features.

All sequences of Terebellides lavesquei sp. nov. share and are distinguished from other available Terebellides sequences in unique combinations of nucleotides (underlined) at the given position of our alignment: 78-99: TCAACCCGGTGCTTACCTCGGT, 156-174: TTTAGTTATGCCAGTCTTC, 261-264: GTTA, 270-279: TCCAGCACTT, 315-336: AGTTGGGACCGGTTGAACCGTT, 351-369: AGACAATATAGCTCATGCG, 405-411: CTTGGCT, 426-447: CCTAGGATCAATTAACTTTATC, 459-483: CAACATACGCTGAAAAGGTTTACGA, 510-525: GTCCGCGGTTATCACA, 534-558: ACTTCTTTTATCCCTTCCAGTCTTG, 573-580: CATGCTTC, 606-627: CTTTTTCGACCCAGCTGGTGGG.

Type locality.

Hordaland, Lysefjord (Norway), 60°07'N, 05°04'E; 119 m deep.

Distribution and bathymetry.

Norwegian coast and shelf, Skagerrak; 115-534 m deep; ~ 50% of specimens collected at depths above 200 m (Figs 10B View Figure 10 , 11 View Figure 11 , Suppl. material 1).

Etymology.

This species is dedicated to Nicolas Lavesque, Station Marine d’Arcachon, CNRS (France) for his remarkable recent contributions to the diversity of Terebellidae and Trichobranchidae in Atlantic waters.

Remarks.

Terebellides lavesquei sp. nov. is a medium-sized species, reaching up to 35 mm in length. It is characterised by the lack of papillae on margins of branchial lamellae and by having branchiae of type 2, filaments on ventral branchial lobes, thoracic uncini of type 3 and abdominal uncini of type 2 (Table 1 View Table 1 ). Terebellides lavesquei sp. nov. is genetically close to T. shetlandica and T. atlantis but mostly differs from them regarding branchiae features (Table 1 View Table 1 ). Lobes are partially fused and have many tightly packed lamellae (17-42) in comparison with these species. Terebellides lavesquei sp. nov. is also similar to Terebellides parapari Lavesque, Hutchings, Daffe, Nygren & Londoño-Mesa, 2019 in having filaments in ventral branchial lobes and the presence of glandular regions, but they differ in the branchial morphology, with lobes fused ca. half of their length in T. lavesquei sp. nov. and fused only at the base in T. parapari . They also differ in TC 1 notochaetae length, being all similar in T. lavesquei sp. nov. but longer than those in following chaetigers in T. parapari .

Branchial shape of T. lavesquei sp. nov. is similar to that of Terebellides narribri Hutchings & Peart, 2000, because both lobes are fused to each other for ca. half their length and have a high number of tightly packed lamellae. However, T. narribri have thoracic uncini of type 1 whereas T. lavesquei sp. nov. have thoracic uncini of type 3. Furthermore, T. lavesquei sp. nov. and T. shetlandica seem to have a more restricted bathymetric distribution in shallow waters (down to 534 and 375 m, respectively) whereas T. atlantis reaches depths of 2750 m (see below).