Dicranomyia (Idiopyga) intricata Alexander, 1927

Salmela, Jukka, Kaunisto, Kari M & Vahtera, Varpu, 2014, Unveiling of a cryptic Dicranomyia (Idiopyga) from northern Finland using integrative approach (Diptera, Limoniidae), Biodiversity Data Journal 2, pp. 4238-4238 : 4238

Dicranomyia (Idiopyga) intricata Alexander, 1927

Materials

Type status: Holotype. Occurrence: recordedBy: O. Bryant; individualCount: 1; sex: male; Taxon: genus: Dicranomyia; subgenus: Idiopyga; specificEpithet: intricata; scientificNameAuthorship: Alexander; Location: country: Canada; stateProvince: Alberta; verbatimLocality: Lesser Slave Lake; verbatimLatitude: 55.35; verbatimLongitude: -115.09; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Event: eventDate: 1924-8-1; Record Level: institutionCode: USNM

Type status: Paratype. Occurrence: recordedBy: O. Bryant; individualCount: 1; sex: male; Taxon: genus: Dicranomyia; subgenus: Idiopyga; specificEpithet: intricata; scientificNameAuthorship: Alexander; Location: country: Canada; stateProvince: Alberta; verbatimLocality: Lesser Slave Lake, Grizzly mt.; minimumElevationInMeters: 914; Event: eventDate: 1924-8-15; Record Level: institutionCode: USNM

Type status: Holotype. Occurrence: catalogNumber: 855 ; recordedBy: H. Frantz; individualCount: 1; sex: male; Taxon: genus: Dicranomyia; subgenus: Idiopyga; specificEpithet: suecica; scientificNameAuthorship: Nielsen; Location: country: Sweden; stateProvince: Abisko; verbatimLatitude: 68.35; verbatimLongitude: 18.79; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Event: eventDate: unknown; Record Level: institutionCode: ZMUC

Type status: Other material. Occurrence: recordedBy: P.T. Bruggemann; individualCount: 1; sex: male; Taxon: genus: Dicranomyia; subgenus: Idiopyga; specificEpithet: intricata; scientificNameAuthorship: Alexander; Location: country: Canada; stateProvince: Yukon; verbatimLocality: Dawson; minimumElevationInMeters: 335; Event: eventDate: 1949-8-6; Record Level: institutionCode: USNM

Type status: Other material. Occurrence: recordedBy: W.W. Moss; individualCount: 1; sex: male; Taxon: genus: Dicranomyia; subgenus: Idiopyga; specificEpithet: intricata; scientificNameAuthorship: Alexander; Location: country: Canada; stateProvince: British Columbia; verbatimLocality: Telegraph Creek; minimumElevationInMeters: 335; Event: eventDate: 1960-8-28; Record Level: institutionCode: USNM

Type status: Other material. Occurrence: recordedBy: W.W. Moss; individualCount: 1; sex: male; Taxon: genus: Dicranomyia; subgenus: Idiopyga; specificEpithet: intricata; scientificNameAuthorship: Alexander; Location: country: Canada; stateProvince: British Columbia; verbatimLocality: Telegraph Creek, Sawmill Lake; Event: eventDate: 1960-8-18; Record Level: institutionCode: USNM

Type status: Other material. Occurrence: recordedBy: O. Bryant; individualCount: 1; sex: male; Taxon: genus: Dicranomyia; subgenus: Idiopyga; specificEpithet: intricata; scientificNameAuthorship: Alexander; Location: country: Canada; stateProvince: Northwest Territories; verbatimLocality: Aklavik; Event: eventDate: 1931-8-27; Record Level: institutionCode: USNM

Type status: Other material. Occurrence: catalogNumber: JES-20120082 ; recordedBy: J. Salmela; individualCount: 1; sex: female; Taxon: genus: Dicranomyia; subgenus: Idiopyga; specificEpithet: intricata; scientificNameAuthorship: Alexander; Location: country: Finland; stateProvince: Lapponia kemensis pars occidentalis; verbatimLocality: Kittilä, Mustaoja-Nunaravuoma Mire Conservation Area, Mustaoja W; verbatimLatitude: 67.6390; verbatimLongitude: 25.4277; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Event: samplingProtocol: sweep net; eventDate: 2009-8-19; habitat: rich flark fen; Record Level: institutionCode: ZMUT

Type status: Other material. Occurrence: catalogNumber: DIPT-JS-2014-0336 ; recordedBy: J. Salmela; individualCount: 32; sex: 29 male, 3 female; Taxon: genus: Dicranomyia; subgenus: Idiopyga; specificEpithet: intricata; scientificNameAuthorship: Alexander; Location: country: Finland; stateProvince: Lapponia enontekiensis; verbatimLocality: Enontekiö, Tarvantovaara Wilderness Area, Tomuttirova W; verbatimLatitude: 68.6369; verbatimLongitude: 22.5381; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Event: samplingProtocol: sweep net; eventDate: 2009-8-26; habitat: swampy flark fen; Record Level: institutionCode: JES

Type status: Other material. Occurrence: catalogNumber: JES-20110082 ; recordedBy: J. Salmela; individualCount: 1; sex: male; Taxon: genus: Dicranomyia; subgenus: Idiopyga; specificEpithet: intricata; scientificNameAuthorship: Alexander; Location: country: Finland; stateProvince: Lapponia enontekiensis; verbatimLocality: Enontekiö, Tarvantovaara Wilderness Area, Tomuttirova W; verbatimLatitude: 68.6369; verbatimLongitude: 22.5381; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Event: samplingProtocol: sweep net; eventDate: 2009-8-26; habitat: swampy flark fen; Record Level: institutionCode: ZMUT

Type status: Other material. Occurrence: catalogNumber: DIPT-JS-2014-0337 ; recordedBy: J. Salmela; individualCount: 10; sex: 5 male, 5 female; Taxon: genus: Dicranomyia; subgenus: Idiopyga; specificEpithet: intricata; scientificNameAuthorship: Alexander; Location: country: Finland; stateProvince: Lapponia enontekiensis; verbatimLocality: Enontekiö, Tarvantovaara Wilderness Area, Tomuttirova N; verbatimLatitude: 68.6391; verbatimLongitude: 22.5518; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Event: samplingProtocol: sweep net; eventDate: 2009-8-26; habitat: intermediate rich flark fen; Record Level: institutionCode: JES

Type status: Other material. Occurrence: catalogNumber: DIPT-JS-2014-0182 ; recordedBy: J. Salmela; individualCount: 1; sex: male; Taxon: genus: Dicranomyia; subgenus: Idiopyga; specificEpithet: intricata; scientificNameAuthorship: Alexander; Location: country: Finland; stateProvince: Lapponia kemensis pars orientalis; verbatimLocality: Sodankylä, Pomokaira-Tenniöaapa Mire Conservation Area, Syväkuru; verbatimLatitude: 67.8718; verbatimLongitude: 26.2126; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Event: samplingProtocol: Malaise trap; eventDate: 2013-8-15/9-19; habitat: spring fen; Record Level: institutionCode: JES

Type status: Other material. Occurrence: catalogNumber: DIPT-JS-2014-0338 ; recordedBy: J. Salmela; individualCount: 4; sex: 1 male, 3 female; Taxon: genus: Dicranomyia; subgenus: Idiopyga; specificEpithet: intricata; scientificNameAuthorship: Alexander; Location: country: Finland; stateProvince: Ostrobothnia borealis pars borealis; verbatimLocality: Kemijärvi, Salmiaavanhete; verbatimLatitude: 66.9929; verbatimLongitude: 27.0578; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Event: samplingProtocol: sweep net; eventDate: 2009-8-15; habitat: rich flark fen; Record Level: institutionCode: JES

Type status: Other material. Occurrence: catalogNumber: DIPT-JS-2014-0340 ; recordedBy: J. Salmela; individualCount: 1; sex: 1 female; Taxon: genus: Dicranomyia; subgenus: Idiopyga; specificEpithet: intricata; scientificNameAuthorship: Alexander; Location: country: Finland; stateProvince: Lapponia inariensis; verbatimLocality: Inari, Kaunispää; verbatimLatitude: 68.4461; verbatimLongitude: 27.4351; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Event: samplingProtocol: sweep net; eventDate: 2013-8-16; habitat: alpine wetland; Record Level: institutionCode: JES

Description

Dicranomyia intricata Alexander 1927: 221 (original description)

Limonia (Dicranomyia) suecica Nielsen 1953: 34 (original description)

Limonia (Dicranomyia) suecica Tjeder 1958: 160 (distribution, figure of hypopygium on p. 157)

Dicranomyia (Idiopyga) intricata Salmela 2011b: 224 (distribution, ecology)

The holotype specimen of D. (I.) intricata (Fig. 7a) is in good condition, dry and pinned, hypopygium is not detached. Alexander ( Alexander 1927, fig. 1) permanently slide-mounted and illustrated his paratype specimen (Fig. 7b). The holotype of Dicranomyia suecica Nielsen was re-described and well illustrated by Tjeder ( Tjeder 1958) and the species was proposed as a synonym of D. (I.) intricata by Savchenko et al. 1992. Unfortunately the male hypopogiym of D. suecica is lost (T. Pape, personal communication), but based on Tjeder's detailed illustrations this nomenclature can be verified. Alexander's original description is good, and there is no need to thoroughly re-describe this species. However, male and female genitalia are illustrated here and diagnostic characters are discussed under D. (I.) boreobaltica Salmela sp.n.

Male hypopygium. 9th tergite and proctiger as in Fig. 8. Gonocoxite dark brown, sparsely covered with dark setae. Ventromesal lobe of gonocoxite as in Fig. 9. The main lobe (lgx) club-like, straight and elongated, apex beak-like, having medially patch of hyaline curly setae (Fig. 9). The appendage of ventromesal lobe (algx) as in Fig. 9. Inner appendage of gonocoxite (iagx, Fig. 10a, b, c) sclerotized, curved, apically with a number of stout, short setae; apex of iagx bilobed. Structure of gonostylus as in D. (I.) boreobaltica Salmela sp.n., see Fig. 10a, b, c. Ventrobasal lobe of ventral gonostyle (lvg) tail-like, slightly sinuous, weakly sclerotized, having patches of hyaline setae both basally and apically; its stalk narrowing toward apex; apex of lvg spherical (Fig. 9). Rostrum (rm) light brown, apically widest, bearing two strong spines (Fig. 10a). Subrostral prolongation of ventral gonostyle (srm) strongly sclerotized, bilobed, very robust, approximately as long as rm, almost parallel with rm; srm with number of median and subapical stout black spines, apical spines are hyaline/light brown (Fig. 10b, c, d). Ventral surface of aedeagus bearing hyaline setosity, lateral margins of parameres rather strongly serrated (Fig. 11). See also Suppl. material 1.

Female postabdomen. Cerci and hypogynial valves, see Fig. 12.

Distribution

Holarctic. Known from Canada (Alberta, Northwest territories, British Columbia), Sweden (North Sweden, Abisko, Nielsen 1953, Tjeder 1958) and Finland. In Finland D. (I.) intricata is known from the north boreal ecoregion, both from the zone of coniferous forests and from the subarctic fell area in the northernmost part of the country (Fig. 14

Ecology

The original description of D. (I.) intricata ( Alexander 1927) was based on material collected from "Muskeg" bogs. Muskegs are nutrient poor peatlands dominated by Sphagnum mosses (http://en.wikipedia.org/wiki/Muskeg). Most of the Finnish sampling sites are aapamires, that is, minerotrophic fens with wet, usually moss covered, flarks (hollows) and drier hummock-level strings. Most of the sites are intermediate rich or rich fens, characterised by brown mosses (e.g. Warnstorffia , Scorpidium , Paludella ). The species was especially abundant on two closely lying intermediate rich, Sphagnum dominated aapamires in Enontekiö, NW Finnish Lapland, but single specimens were also caught along a spring and a headwater stream ( Salmela 2011a). The species is on the wing from mid August to early September.

Conservation

Dicranomyia (I.) intricata is red-listed in Finland (NT, Penttinen et al. 2010). At the time of the assessment, it was not known that D. (I.) intricata is absent from the northern Baltic coastal area and is replaced there by a sibling species ( D. (I.) boreobaltica sp.n. Salmela). Thus the range ("extent of occurrence") of D. (I.) intricata is actually smaller that was thought in the 2010 assessment. However, the species is not extremely rare and there are most likely hundreds of square kilometres of suitable breeding sites for the species in Finnish Lapland. Nevertheless, the species may be jeopardized by climate change and it may also be used as an indicator of pristine boreal mires.

Taxon discussion

See Dicranomyia (I.) boreobaltica Salmela sp.n.

DNA barcode

Standard 5′ region (658 bp) of the cytochrome c oxidase I (COI) gene of Dicranomyia (I.) intricata (BOLD Sample IDs JES-20120082 and JES-20110082, identical specimens):

TACCTTATACTTTATTTTTGGAGCTTGAGCAGGAATAGTAGGAACTTCACTAAGTATTATTATTCGAGCAGAATTAGGACACCCAGGAGCATTAATTGGAGATGACCAAATTTATAATGTAGTAGTTACTGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTCGGTAATTGATTAGTTCCTTTAATATTAGGAGCCCCAGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGAATACTTCCCCCTTCTTTAACCTTATTATTAGCTAGAAGTATAGTTGAAAACGGGGCAGGAACTGGTTGAACAGTTTACCCTCCCCTTTCTTCTGGAATTGCTCATTCAGGAGCTTCTGTAGACTTAGCTATTTTTTCTCTTCATTTAGCAGGTATTTCTTCTATTTTAGGAGCTGTTAACTTTATTACAACTGTTATTAATATACGTTCAGCAGGAATTTCATTCGACCGAATACCATTATTTGTTTGATCAGTAGTAATTACTGCTATTCTATTACTCTTATCACTCCCTGTTTTAGCTGGAGCTATTACAATATTATTAACAGATCGAAACTTAAACACTTCATTTTTTGACCCTGCAGGTGGAGGAGATCCTATTTTATACCAACACTTATTT