Homaledra knudsoni Hayden, 2021

Hayden, James E., 2021, Two new species of palm-leaf skeletonizers (Lepidoptera: Pterolonchidae: Homaledra Busck), Insecta Mundi 2021 (859), pp. 1-24 : 15-18

Homaledra knudsoni Hayden , new species

( Fig. 5–7, 10 , 13, 19, 24 , 32, 33 , 36 , 40, 43, 47 , 56–59 )

Type material. Holotype: ♂: [white label] “ Cameron Co. Tex. Brownsville leg. E.C. Knudson 27-X-86” ( MGCL).

Paratypes: MEXICO: 1♂: Quintana Roo, Allen Point Ascension Bay , 17-IV-1960, J.F.G. Clarke, [green label] Genitalia Slide By RWH, male, USNM 15 , 045 , R.W. H. #788, 20-IX-1960, Homaledra sabalella (Chamb.) (USNM) . USA: Florida: Alachua Co. : 1♂: Gainesville, UF Campus, FLMNH Butterfly Rainforest , UV trap, XI-2011, Hansen and Fessenden ; 1♀: same data, MGCL slide 4439 ; 1♂: same data, MGCL slide 4440 ; 2♂: Gainesville, 3215 Hull Rd. , UF Butterfly Rainforest, larva on Washingtonia robusta , 19-XI-2017, J. Hayden, K. Curry, E17-4800 ; 1♂: Gainesville , Split Rock C.A., 29.63658, −82.40965, Pupa on cabbage palm, 12-IX-2017, J. Hayden, eclosed 25-IX-2017, E2017-3805 ; 1♀: same data, MGCL slide 4437 ; 1♂: same data, MGCL slide 4438 ; 2♀: Gainesville, UF NATL, SW 34 St. & 24 Ave. , 29.63038, −82.37226, on Sabal palmetto leaf, 28-XI-2017, J. Hayden ; 5♂, 2♀: same data except 29.6307, −82.3718, 9-VI-2018 ; 3♂, 4♀: same data except 29.6345, −82.3704, 16-VIII-2018 ; 5♂, 2♀: same data except 29.3663, −82.3706, 13-VIII-2018, J. Hayden, H.A. Rohrer ; 1♀: same data except 29.3663, −82.3706, 13-VIII-2018, J. Hayden, H.A. Rohrer, MGCL slide 5007 (wings) ; 1♂, 3♀: Gainesville, 3722 SW 19 St. , 29.617956, −82.348579, on Sabal palmetto , 24-I-2018, P. Skelley, J. Hayden, E18-236 (1♂: USNM, rest FSCA) ; 1♂: same data, slide MGCL 4580 ( FSCA) ; 2♂, 2♀: Gainesville, SW 41 Pl. south of UF TREEO, ex Sabal palmetto leaf, NW side of road, 22-X-2017, J. Hayden ; 2♂, 3♀: Micanopy, County Rd 346, bridge at River Styx , 29.517163, −82.222084, ex S. palmetto leaf, 22-X-2017, J.S. Bremer, E17-4018 (1♂, 1♀: USNM, rest FSCA) ; 1♀: Micanopy, 13207 SW Williston Rd., on S. palmetto , 5-III-2018, J. Hayden, J.Y. Miller, E18- 845, MGCL slide 4673 ; 1♂, 1♀: Gainesville, Museum Rd west of Lake Alice , larva on Sabal palmetto leaf, 26-XI-2017, J. Hayden (♀: USNM, ♂: FSCA) ; 1♂, 1♀: Gainesville, 2004 SE 41st Ave. , 29.6164, −82.2987 Sabal palmetto , 21-VII-2018, J. Hayden, E. Robertson, J. Mays, J. Awad, E18-4053 ; 1♂: 6400 SW 20 th Ave. , 29.64142, −81.41091, UV light, 23–24- II-2019, J. Hayden ; 4♂: Gainesville, across from 6400 SW 20th Ave. , 29.6394, −82.4100, Sabal palmetto , 3-VI-2018, J. Hayden ; 1♂: same data, MGCL slide 5004 (wings) ; 2♂, 10♀: Gainesville, 10014 SW 87 Terrace, Reared from leaf of Sabal palmetto , leaf coll. 7-XI-2018, Lyle J. Buss ; 1♂: same data, MGCL slide 5015 (1♂, 1♀: USNM, rest FSCA) ; 1♂: Gainesville, 2832 NW 41 st Place , 29.6922, −82.3650, UV light trap, 24–25-IX-2019, J. Hayden ; 1♂: same data except 25-III-2020, UV light ; Brevard Co.: 1♂: Cocoa, 1545 Alligator Lane , 28.3838, −80.7980, on S. palmetto (?), 17-IV-2018, D. Cermak, E18-1920 ; 1♂: Melbourne , Weston Park, UV, 8-XII-2017, M.F. Blaine ; 1♂: same data, 9-I-2018 ; Citrus Co.: 2♀: Floral City, 9065 E. Bushnell Rd. on Sabal palmetto , 15-V-2018, J. Hayden, E18-3023 ; 1♂: same data, MGCL slide 5005 (wings) ; Collier Co.: 2♀: Naples, Delnor-Wiggins Pass State Park , malaise trap, 24-IV–27-V-2020, D. Serrano ; Duval Co.: 2♂: St. Johns Bluff, Timucua National Park , Fort Caroline , 30°23′09″N 81°29′49″W, malaise trap, 24-VIII– 7-IX-2018, E. Talamas, D. Taradona ; 1♂: same data except Ribault Column , 30°23′16.4″N 81°29′21.5″W, malaise trap, 2–23-XI-2018, MGCL slide 5185 ; Gilchrist Co.: 3♂: Trenton, Rte 26 x SW 15 Ct , 29.6137, −82.8330, ex S. palmetto leaf, 18-X-2017, M. Standridge, J. Bremer, E17-4013 ; Hernando Co.: 1♀: Brooksville, E. side La Pine Rd. 28.5196, −82.2615, on Sabal palmetto , 28-IV-2018, N. Marquez, E18-1403, MGCL slide 5006 (wings) ; Indian River Co.: 1♂: Vero Beach , FL A1A, 27.6348, −80.3577, on Serenoa repens , 1-XI-2018, A. Tasi, E18-6027 ; 1♀: Vero Beach, Cap. Forster Hammock Prsv. , 27.5710, −80.4004, reared on S. palmetto leaf, 17-X-2018, A. Tasi, E18-5795 ; 4♀: Vero Beach, 6618- 7072 9 St. SW-Oslo Rd. , 27.587°N, 80.464°W, 4-XI-2018, T. Greenwald, M.E. Flowers, E18-5798 ; 1♂: 11738-11360 CR 512, St. Sebastian Prsv. , 27.768°N, 80.564°W, 4-XI-2018, T. Greenwald, M.E. Flowers, E18-5856 ; 2♂, 2♀: Vero Beach, 4593-4599 Blue Cypress Rd. , 27.726°N, 80.776°W, 4-XI-2018, T. Greenwald, M.E. Flowers ; 1♂: Vero Beach , 4016-4050 CR 512, 27.645°N, 80.643°W, 4-XI-2018, T. Greenwald, M.E. Flowers ; Lake Co.: 2♂, 2♀: Howey in the Hills , Highway 19, 28.699279, −81.780483 on S. palmetto (?), 21-II-2018, N. Marquez, A. Bartlett, E18-688 ; 1♂: same data except E18-689, MGCL slide 4608 ; 1♀: Tavares, Lake Idamere Park , 28.76455, −81.74842 ex frass on S. palmetto , 16-V-2018, J. Hayden, E18-2826 ; 3♂: same data except 3-X-2018, J. Hayden, E18-5348 ; Levy Co.: 3♂, 6♀: US 41 N. of Williston , 29.41196, −81.45341, Sabal palmetto , 22-IV-2018, J. Hayden, E18-2064 ; Marion Co.: 1♂: Ocala, IFAS Extension , 2232 NE Jacksonville Rd. 29.21114, −82.13074, on Sabal palmetto , 29-I-2018, J. Hayden, B. Danner, E18-846, MGCL slide 4615 ; 2♂, 2♀: Ocala, 9036 W. Anthony Rd. , 29.28211, −82.13057, Sabal palmetto , 4-III-2018, J. Hayden, T. Dickel, E18-946 ; 1♀: same data, MGCL slide 5003 (wings) ; 1♂, 3♀: same data except 29.28231, −82.12926, E18-1012 (1♀: USNM, rest FSCA) ; 1♀: same data except 29.28332, −82.13414 ; Osceola Co.: 1♂, 1♀: St. Cloud, 4464 La Salle Ave. S., Larvae on Washingtonia robusta , 17-VIII-2018, R. Areingdale, E2018-4414 ; 1♂: same data except E2018-4464 ; 7♂, 3♀: Kissimmee, Joe Overstreet Rd. S. of Canoe Creek Rd. , 15-XII-2017, on Serenoa repens, T. Greenwald, M.E. Flowers, E 18-155 ; 1♂: same data, MGCL slide 4564 ; 1♂: same data, MGCL slide 5008 (wings) ; Palm Beach Co.: 3♂: Royal Palm Beach, 150 Crestwood Blvd N. on S. palmetto , 6-XII-2018, J. Hernandez, E18-6306 ; 1♂: same data, MGCL slide 4990 ; Polk Co.: 2♂: Lake Alfred, CREC Experiment Sta. Rd. , 28.10184, −81.71229, reared on S. palmetto leaf, 10 Jan. 2019, J. Hayden, E19-165 ; 1 larva, molecular analysis: Bartow , 1432 CR 555 S., 4-I-2018, Livistona chinensis, J. Bryan, R. Areingdale, E 18-54 ; Putnam Co.: 1♂, 1♀: 3.2 mi. SE of Hawthorne, vic. Little Orange Lake , 29.568291, −82.041721, on Sabal palmetto leaf, 8-X-2017, T.A. Lott, D. Matthews, E2017-3858 ; 1♀: same data, MGCL slide 4449 ; Sumter Co.: 1♀: Sumterville , E. side CR 529A, 28.7459, −82.0862, on S. palmetto , 9-III-2018, N. Marquez, E18-1003 ; Volusia Co.: 1 larva, molecular analysis: De Land , 29.09227, −81.33740, 29-I-2018, Sabal palmetto, K. Loadholtz, E 18-323 ; 1♂: Osteen, 492 Pell Rd. , 28.852463, −81.068803, on S. palmetto , 12-II-2018, K. Coffey, E18-659 ; 1♂: Pierson, 1725 Stone Rd. , 29.1854, −81.4826, on Jax. trap, 10-XII-2018, P. Sullivan, E18-6407 ; TEXAS: Cameron Co.: 1♂: same data as holotype ( MGCL) ; 1♂: Southmost, 27-X-1986, E.C. Knudson, Barcode of Life DNA voucher specimen, SampleID CCBD-28560-D04, BOLD Proc. ID: LNAUU040-15, USNMENT 01048494 ( USNM) ; 1♂: same data except “Southmost”, MGCL slide 4442 ; 1♀: Sabal Palm Sanct. , 4,5- XII-1994, E. Knudson; 1♀: same data except 29-IV-1995, MGCL slide 4441 .

Other material examined. USA: Florida: Alachua Co. : 1♂: Gainesville, UF NATL, SW 34 St. & 24 Ave., 29.63038, −82.37226, Pupa on Sabal palmetto leaf, 9-X-2017, J. Hayden, MGCL slide 4448; 1 larva: same data except 29.6304, −82.3717; 1♀: same data except 29.63446, −82.37056, 5-X-2017; 1 larva: Gainesville, UF NATL, SW 34 th St., 29.6336, −82.3706, on Sabal palmetto , 13-VIII-2018, J. Hayden, H.A. Rohrer, MGCL slide 4854 (larval cuticle); 1 larva (molecular sequencing): same data except: sample JEH20180813E; 1 larva: Gainesville, NATL, 29.6345, −82.3704, 16-VIII-2018, Sabal palmetto, J.E. Hayden ; 1 larva (molecular sequencing): Gainesville, SW 41 Pl. S. of UF TREEO, ex Sabal palmetto leaf on NW side of road, 22-X-2017, J. Hayden, sample JEH20171121A; 3 larvae: Gainesville, NATL, 15-XII-2018, Sabal palmetto, J.E. Hayden, K. Ellis ; 1 larva: Gainesville, FLMNH Butterfly Rainforest, 19-XI-2017, Washingtonia robusta, K. Curry, J.E. Hayden ; 2 larvae: Gainesville, 3722 SW 19 St., 29.6180, −82.3486, 24-I-2018, Sabal palmetto, J.E. Hayden, P. Skelley ; 1 larva: Micanopy, 29.5172, −82.2221, 22-X-2017, Sabal palmetto, J. Bremer ; 1 larva: Micanopy, 13207 SW Williston Rd., 5-III-2018, Sabal palmetto, J.E. Hayden, J.Y. Miller ; Brevard Co.: 2 larvae: Cocoa, 28.3838, −80.7980, 17-IV-2018, Sabal palmetto, D. Cermak ; Columbia Co.: 2 larvae (1 preserved, 1 molecular sequencing): Lake City, 30.1753, −82.6325, 19-I-2019, Sabal palmetto, M.E. Flowers, T. Greenwald, E2019 -212; Hernando Co.: 2 larvae: Brooksville, La Pine Rd., 24.5196, −82.2615, 28-III-2018, Sabal palmetto, N. Marquez ; Hillsborough Co.: 1♂: Seffner, 8682 Williams Rd., on Butia capitata , 15-II-2018, T. Streeter, MGCL slide 4601; 1 larva: same data, not slide-mounted; Indian River Co: 2 larvae: Vero Beach, 27.5870, −80.4640, 4-XI-2018, Sabal palmetto, T. Greenwald, M.E. Flowers ; Lake Co.: 1 larva, 2 pupae: Clermont, 28.554211, −81.747638, on Sabal palmetto , 16-I-2018, A. Bartlett, N. Marquez, E2018-175; 1 pupa: Howey in the Hills, on S. palmetto , 2-II-2018, N. Marquez, A. Bartlett; 1 pupa: Howey in the Hills, 28.6993, −81.7805, 21-III-2018, Sabal palmetto, N. Marquez, A. Bartlett ; 1 larva: Tavares, 28.7646, −81.7484, 16-V-2018, Sabal palmetto, J.E. Hayden ; 4 larvae: same data except 3-X-2018; Marion Co.: 1 larva: Ocala, 29.2821, −82.1306, 4-III-2018, Sabal palmetto, J.E. Hayden, T.S. Dickel ; Osceola Co.: 1 larva: Kenansville, Three Lakes WMR, 27.942, −81.152, 2-XI-2018, Serenoa repens, M. Flowers, T. Greenwald ; 2 larvae (molecular samples): St. Cloud, 4464 La Salle Ave. S., 17-VIII-2018, Washingtonia robusta, R. Areingdale , samples E2018-4413, E2018-4414; Palm Beach Co.: 5 larvae, 1 pupa: Royal Palm Beach, on S. palmetto , 6-XII-2018, J. Hernandez; Polk Co.: 2 larvae: Bartow, 1432 CR 555 S., on Livistona chinensis , 4-I-2018, J. Bryan and R. Areingdale, E2018-54; Sumter Co.: 2 larvae: Sumterville, 28.7459, −82.0862, 9-III-2018, Sabal palmetto, N. Marquez ; Volusia Co.: 1 larva: De Land, 29.09227, −81.33740, on Sabal palmetto , 29-I-2018, K. Loadholtz, E2018-323.

Diagnosis. Adult. The antennae are distinctly longer than the forewings and gray at the apex, whereas they are shorter than the wings and unicolorous in H. sabalella . Most specimens have a pecten on the scape, which H. sabalella lacks. The forewings are beige with white scales on the veins, especially along the radial veins ( Fig. 5, 6, 7 ). The terminal black spots are more prominent and extend farther basad, including a spot at the end of R1 (anterior of the discal spot) and in some specimens basad of R1. Forewing vein M 1 is close or anastomoses with Rs 3+4, the forewing CuA veins are usually separate or less often fused, and the hind wing CuA veins are separate ( Fig. 36 ). The hind wings are darker gray than those of H. sabalella . The male tergum has slightly enlarged pleural scales but is otherwise unmodified ( Fig. 13 ). Male genitalia: The cornuti are large, numerous, and melanized ( Fig. 24 ). Female genitalia: The corpus bursae is pyriform in shape, widest at the anterior end ( Fig. 32 ). The signum is a diffuse, elongate zone of granules on anterior end of the corpus bursae ( Fig. 33 ). Larva ( Fig. 40 ). The subventral group on A3–A6 has four setae of similar size: one anterior of the proleg and three anterolateral of it ( Fig. 43 ). Pupa ( Fig. 47 ). The antennae and metathoracic legs are longer than wings and are extended to the end of the 6 th abdominal segment; the antennae are tangent, concealing the legs at the 3 rd abdominal segment.

The signum of H. sabalella and H. howardi has a discrete edge and bears spines. Homaledra citraula (Meyrick) has cornuti that are similarly large and melanized ( Clarke 1965: pl. 254 fig. 1a). That species is distinguished by wing pattern, which is yellow with orange and gray streaks.

Description. Head ( Fig. 10 ). haustellum dark gray; maxillary palpi gray; labial palpi with proximal segment gray, second segment dark gray except cream in dorsal 2/5 and around distal margin, without dorsal tuft; distal segment brown with few pale gray scales. Frons entirely dark gray below level of antennae, brown dorsally. Ocelli absent. Antennal scape dorsally brown, ventrally cream with row of single gray scales along anterior edge, pecten of 1 to 5 fine gray scales near base, often lost; pedicel and flagellum mostly brown, gray at apex, longer than wing.

Thorax. Prothorax behind head dark gray; rest of thorax brown dorsally, cream ventrally. prothoracic leg coxa gray, femur gray, tibia gray with dark gray and cream scales, bearing erect hairlike scales along whole length of dorsal side; tarsi gray and pale brown. Mesothoracic leg femur gray, tibia gray, tarsus pale brown; one pair of tibial spurs present. Metathoracic leg mostly cream except tibia pale gray along whole dorsal side, with long hairlike scales; two pairs of tibial spurs present. Forewing ( Fig. 5, 6, 7 ) length 6.0–9.0 mm, usually 7.0 mm or longer (n = 20); dorsal side brown, with cream scales along veins, especially in distal half; a black spot at distal end of discal cell, another black spot along anal fold, and veins terminating in black spots on anterior and posterior margins; costal margin cream; ventral side gray; fringe gray. Forewing venation: Rs 4 stalked with Rs 3, M 1 variably parallel to Rs 3 +Rs 4, stalked with them, or anastomosed with Rs 4; CuA 1 and CuA 2 separate in most specimens, stalked in one specimen ( Fig. 36 ). Hind wings with dorsal and ventral sides and fringe uniformly gray. Hind wing venation: M 1 and M 2 shortly stalked; M 3, CuA 1, and CuA 2 present and separate.

Abdomen. Dorsal side brownish gray, ventral side cream; eighth segment gray in female, brown in male.

Male genitalia ( Fig. 19, 24 ). Uncus hooked, slightly enlarged medially; gnathos absent; transtilla a pair of narrow sclerotized straps in membrane, meeting mesally; juxta a broad pentagon, ventral margin straight or slightly concave; valva elongate, without fibula, setose along ventral half, with few setae along dorsal half, the proximal half of costa being rather strongly arched; saccus not pronounced; tegumen with sclerotized medial longitudinal ridge. Phallus with sclerotized strap entire length; large cornuti in one large field on vesica.

Female genitalia ( Fig. 32, 33 ). Ostium bursae without sclerites; colliculum present; ductus seminalis attached to ductus bursae just anteriad of colliculum; anterior end of ductus bursae with granular texture on one side. Corpus bursae slightly shorter than ductus bursae; anterior section 1 mm long, ovate; posterior section 1.5 mm, narrow and straight; one longitudinally elongate, diffuse signum occupying most of anterior section.

Larva ( Fig. 40, 43 ). SV group on A3–A6 with 4 large setae:1 anterior of crochets and 3 anterolateral of crochets. Etymology. The species is named after Dr. Edward C. Knudson, who collected specimens in the Lower Rio Grande Valley as part of his decades-long Texas Lepidoptera Survey. His donation of specimens to the Florida Museum of Natural History allowed timely recognition of this species’ probable origin.

Distribution. Fig. 59 . Southern Texas, Mexico (Yucatan Peninsula), and peninsular Florida, from Duval County in the north to Palm Beach and Collier Counties in the south.

Hosts plants. This species is most frequently reared on Sabal palmetto and Washingtonia robusta , infrequently on Butia capitata , Livistona chinensis , and Serenoa repens . It is reported on Trachycarpus H. Wendl. in cultivation (R. Fessenden, FLMNH, pers. comm. 2018).

Larval behavior. The larvae coexist in large numbers in frass-covered silken tubes on protected parts of leaves, usually the abaxial side, but also the adaxial side along the rachis when deeply folded. The tunnels are as wide as the larvae, and they wind randomly across the leaf surface in large patches ( Fig. 56, 57 ). During the day, larvae often hide in sections of the tubes near the base of the leaf. If larvae are difficult to find, active damage can be recognized by the leading ends of frass tubes with fresh, greenish frass extending onto undamaged epidermis ( Fig. 58 ). The larvae do not bind leaf sections with thick mats of silk, unlike H. sabalella .

Remarks. This species is figured in Knudson and Bordelon (2008), plate 2, fig. 10, misidentified as H. sabalella . It is apparently geographically separated from H. sabalella in eastern Texas (E. Knudson, pers. comm. 2018). This species probably appeared in Florida as early as 2006, evidenced by a photograph of a moth posted on Bugguide. net (Lady Lake, Lake County, FL, 29 Nov. 2006) ( White 2006). Figures 2–4 in Howard and Abreu (2007) show leaf damage that is characteristic of H. knudsoni rather than H. sabalella ; that would be contemporaneous, but the locations and exact dates of their photographs are not given. Specimens of H. knudsoni were not found among Howard’s reared material.

Homaledra knudsoni is represented by BIN BOLD:ACJ4987 (https://doi.org/10.5883/BOLD:ACJ4987), which is based on two specimens: USNMENT 01048494 and GenBank accession JF818757.1. The latter sample (voucher no. MM11439) was misidentified as H. sabalella and included in the gelechioid phylogeny of Kaila et al. (2011). The larvae were collected in Gainesville in 2010 (L. Buss, pers. comm. 2019). Five other genes were sequenced, so the amended identification should not affect the higher-level phylogenetic conclusion that Homaledra is associated with Pterolonchidae .

The COI barcode sequences have the same haplotype; for example, the sequence of E2018-4413 is:

TTTGAGCAGGAATAGTAGGAACTTCTCTTAGTCTTCTAATTCGAGCTGAATTAGGAAATCCAGGTTCTTTAATTGGAGA TGATCAAATTTATAATACAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGG ATTTGGAAATTGATTAGTCCCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGAC TTCTTCCCCCTTCTTTAACTCTTCTTATTTCAAGAAGAATTGTTGAAAGAGGAGCAGGAACTGGATGAACAGTATATCC CCCACTTTCATCCAATATTGCCCATGGAGGTAGATCTGTAGATCTAGCAATCTTTTCTTTACATTTAGCAGGAATTTCAT CAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATATATCATTTGATCAAATACCTTTATT TGTATGAGCAGTAGGAATTACTGCTTTACTACTTTTACTCTCTTTACCCGTTTTAGCTGGTGCAATTACCATATTATTAA CTGATCGTAATTTAAATACATCATTTTTTGACCCTGCAGGAGGAGGAGA

Other sequences available on GenBank with the following accession numbers (full data in Material Examined): sample JEH20180813E: MW549056 ; E2017-3858: MW549057 ; JEH20171121A: MW549058 ; E2018-4413: MW549059 ; E2019-212: MW549060 .

Other species. The species raised by Abreu in Puerto Rico ( Howard and Abreu 2007) is not conspecific with H. howardi . It resembles H. howardi in that the beige wings have scattered black scales not concentrated in spots, and the males also have a distinct tuft of scales on the dorsal abdomen. Unlike H. howardi , the scales are short, fine, erect and black in color, forming a circular cushion-like patch. Tergum II narrows as a triangle instead of a Y, and there is a pocket of scales on the membrane between terga II-III that is revealed after brushing off the black scales. The phallus lacks cornuti except a few small spinules. The valvae are narrower than any other species. In the female, the corpus bursae is carrot-shaped, broadest posteriad where it meets the ductus bursae, and a signum is absent.

Homaledra heptathalama Busck distinctly differs in its orange wing pattern with a central exclamation point “!” ( Fig. 48 ). Males lack a dorsal abdominal scale tuft ( Fig. 14 ), the apex of the valva is more strongly attenuate than that in the other species ( Fig. 20 ), and cornuti are absent ( Fig. 25 ). Females were not examined: all of the numerous pinned specimens of H. heptathalama in the FSCA are males, so females may not be attracted to light, the usual collection method. Rearing females from late-instar larvae should be attempted.

Figures

Figure 59. Distribution in peninsular Florida of H. howardi (red circles) and H. knudsoni (green squares: specimens; yellow triangles: photographs on line).

Figures 1–10. Habitus and heads of Homaledra spp. 1) Homaledra sabalella male (FL, Lake Co.). 2) H. sabalella female (FL, Levy Co.).3) H. howardi holotype male (FL, Miami-Dade Co.). 4) H. howardi female (FL, Miami-Dade Co.). 5) H. knudsoni male (FL, Osceola Co.). 6) H. knudsoni female (FL, Alachua Co.). 7) H. knudsoni holotype male (TX, Cameron Co.). 8) H. sabalella head in lateral aspect (FL, Lake Co.). 9) H. howardi head (FL, Miami-Dade Co.). 10) H. knudsoni head (FL, Alachua Co.). Scales = 5 mm.

Figures 11–26. Male abdominal structures of Homaledra spp. 11–15, cuticle; 16, androconia of hind wings and tergites 2–3; 17–21, male genitalia and phalli; 22–26, cornuti (scales: 0.5 mm). Numbers refer to MGCL slides. 11) H.sabalella (#4257). 12) H. howardi (#3296). 13) H. knudsoni (#4438). 14) H. heptathalama (#4260). 15) H. octagonella (#4542). 16) H. howardi (FL, Miami-Dade Co.).17) H. sabalella (#4257). 18) H. howardi (#3296).19) H. knudsoni (#4438).20) H. heptathalama (#4260).21) H. octagonella (#4542). 22) H. sabalella (#4257). 23) H. howardi (#3296). 24) H. knudsoni (#4580). 25) H. heptathalama (#4260). 26) H. octagonella (#4542). c, cornuti; ps, phallus sclerite; tr, transtilla.

Figures 27–33. Homaledra female genitalia, MGCL slide number given. 27) H. sabalella (#4566). 28) H. sabalella, detail of signum (#4566). 29) H. sabalella, detail of signum (#3303). 30) H. howardi (#4261). 31) H. howardi, detail of signum (#4261). 32) H. knudsoni (#4673). 33) H. knudsoni, detail of signum (#4673). Scale bars = 500 µm.

Figures 34–37. Homaledra wings. MGCL slide number given. 34) H. sabalella (#3321). 35) H. howardi (#3335). 36) H. knudsoni (#5005). 37) H. heptathalama (#5029).

Figures 38–47. Homaledra immature stages.38) H.sabalella, larva.39) H. howardi, larva.40) H. knudsoni, larva.41) H. sabalella, A3 proleg with 3 SV setae. 42) H. howardi, A4 proleg with 3 large and 2 small SV setae. 43) H. knudsoni, A3 proleg with 4 SV setae. 44) Ventral aspect of head of H. howardi showing submental pit (sp). 45) H. sabalella, pupa. 46) H. howardi, pupa. 47) H. knudsoni, pupa. Scales = 100µm.

Figures 48–58. Habitus of other Homaledra species and larval damage. 48) Homaledra heptathalama male (FL, Levy Co., FSCA). 49) H. octagonella male (FL, Putnam Co., FSCA). 50) Damage of H. sabalella on date palm (Phoenix sp.) (FL, Collier Co.). 51) Damage of H. sabalella on Serenoa repens (FL, Lake Co.), with broad frass tunnel. 52) Damage of H. sabalella on Serenoa repens (FL, Levy Co.), dense leaf-tying silk indicated. 53) Damage of H. howardi on Cocos nucifera (FL, Miami-Dade Co.). 54) Detail of same with larva indicated. 55) H. howardi on Livistona chinensis, showing damage on a broad-leaved palm (FL, Miami-Dade Co.). 56) Damage of H. knudsoni on Sabal palmetto (FL, Alachua Co., Gainesville). 57) Same (FL, Alachua Co., Micanopy). 58) Active leading end of frass tunnel (indicated) of H. knudsoni (FL, Alachua Co., Gainesville). Scales = 5 mm.