Cyclopocentrus, 2016
publication ID |
1243-4442 |
persistent identifier |
https://treatment.plazi.org/id/03FCA541-FFBD-FFA3-FF59-F9AEFBF4FAA3 |
treatment provided by |
Felipe |
scientific name |
Cyclopocentrus |
status |
gen. nov. |
CYCLOPOCENTRUS Villemant & Rousse , n. gen.
Figures 1-5
Type species. Cyclopocentrus kombuglu Villemant & Rousse , n. sp. DISTRIBUTION AND ECOLOGY — The genus is so far restricted to the high altitude primary forests of Mt Wilhelm in PNG. Nothing is known about the host species. No other biological data are available; although the deep facial depression found in males is thought to be involved in mating behavior (see discussion).
TABLE 2
Accession numbers and origin of Orthocentrinae DNA sequences from Genbank.
Species Accession number (28S) Accession number (CO1) Country Aperileptus sp FJ396423.1 FJ413663.1 Canada Catastenus femoralis FJ 396426.1 FJ413854.1 Canada Diplazon laetatorius FJ 556496.1 FJ556429.1 Switzerland Megastylus sp AJ302862.1 - Belize Neurateles sp2 EU378752.1 - Finland Neurateles sp3 EU378751.1 - Germany Neurateles sp4 FJ396207.1 FJ414768.1 Canada Neurateles sp5 FJ396312.1 FJ414770.1 Canada Orthocentrus sp1 FJ396320.1 FJ413569.1 Canada Orthocentrus sp2 FJ396307.1 FJ413570.1 Canada Orthocentrus sp3 EU378765.1 - Brazil Orthocentrus sp4 EU378764.1 - South Korea Orthocentrus sp5 EU378758.1 - Madagascar Orthocentrus sp6 FJ556554.1 FJ556487.1 Finland Orthocentrus sp7 FJ396269.1 FJ414822.1 Canada Pantisarthrus sp FJ396254.1 FJ414853.1 Canada Plectiscidea sp FJ396300.1 FJ414890.1 Canada Plectsiscus sp1 FJ396420.1 FJ413554.1 Canada Plectsiscus sp2 FJ396267.1 FJ414719.1 Canada Proclitus sp FJ396293.1 FJ414913.1 Canada Stenomacrus sp1 EU378767.1 - United Kingdom Stenomacrus sp2 EU378768.1 - Brazil Stenomacrus sp3 FJ396387.1 FJ413600.1 Canada Stenomacrus sp4 FJ396434.1 FJ413602.1 Canada Stenomacrus sp5 FJ396218.1 FJ414968.1 Canada Stenomacrus sp6 FJ396370.1 FJ413621.1 Canada Symplecis bicingulata EU 378748.1 - Germany Symplecis sp EU378749.1 - Chile
TABLE 3
Primers and PCR programs.
Primer Sequence Tm (°C) PCR program
LCO1490 5’- GGTCAACAAATCATAAAGATATTGG - 3’ 51.1 94° 2 min.
35 cycles
94° 30 s
HCO2198 5’- TAAACTTCAGGGTGACCAAAAAATCA - 3’ 50.6 44° 30 s
72° 60 s
72° 5 min
Bel28SF 5’ - AGA GAG AGT TCA AGA GTA CGT G - 3’ 54.7 94° 3 min
35 cycles
94° 60 s
Mar28SR 5’ - TAG TTC ACC ATC TTT CGG GTC CC - 3’ 59.9 65° 60 s
72° 60 s
72° 5 min
ETYMOLOGY — The name is a combination of “cyclopo”, from Cyclopes, the gigantic, one-eyed monsters of Greek mythology, and “centrus ” the suffix of Orthocentrus , the genus group to which belongs this new genus.
DIAGNOSIS — The genus Cyclopocentrus n. gen. undoubtedly belongs by its morphological characters to the Orthocentrus genus group (Wahl 1990), i.e. Orthocentrinae sensu Townes (1971) , mostly because of the uniformly convex surface formed by the face and clypeus in the absence of the epistomal sulcus. It can be distinguished from the other genera by
the presence in male of a yellow subcircular depression in the center of face and by the following main characters: lower
mandibular tooth present; malar sulcus deep; notaulus absent; epicnemial carina entirely absent; forewing with areolet open (3rs-m absent), and 2rs-m shorter than abscissa of Cu between 2rs-m and 2m-cu; propodeum rather elongate, with pleural and posterior transverse carina complete; metasoma elongate in both sexes and distinctly compressed apically in female; female ovipositor longer than apical depth of metasoma and weakly upcurved; male with hypopygium apical margin bordered by strong bristles.
DESCRIPTION — MALE ( Figures 1-3, 5a): Head. Antenna uniformly setose; scape long; face weakly convex and evenly setose, with a deep central subcircular concavity whose lateral walls are invaginate; ventral margin of clypeus truncate and distinctly turned outward, exposing the triangular labrum; malar sulcus deep; mandible falcate, twisted 90°, inner tooth very small and located on inner edge; maxillary and labial palpi with 5 and 4 segments respectively; posterior margin of lateral ocellus reaching postoccipital declivity; dorsal face of head abruptly sloping down and without any furrow nor carina. Mesosoma. Almost smooth, mesoscutum and ventral pleurae setose; pronotum with epomia distinct; epicnemial carina and notaulus absent; tegula wide; propodeum almost smooth, with pleural and posterior transverse carinae complete; lateral and median longitudinal carinae reduced to apical stubs; propodeal spiracle circular. Legs. Long and thin, tarsal claws long and simple. Wings. Fore wing with pterostigma short and thin, M opposite cu-a, 3rs-m absent, 2rs-m shorter than abscissa of Cu between 2rs-m and 2m-cu, apical abscissa of M reduced to a short stub, 2m-cu with a single median bulla; hind wing with M-Cu lacking basally, R reduced to a stub, Cu&cu-a inclivous and not intercepted (apical abscissa of Cu lacking). Metasoma. Slightly compressed apically; first and second tergites weakly sculptured, the following ones smooth; apical margin of hypopygium rounded, with a row of strong bristles.
FEMALE ( Figures 4, 5b): Antenna with median flagellomeres lacking differentiated ventral sensillar areas; face convex with a central, slightly concave glabrous area; metasoma elongate and distinctly compressed apically; ovipositor longer than apical depth of metasoma and weakly upcurved. Otherwise similar to male.
COMMENTS — Cyclopocentrus n. gen. lacks an epicnemial carina like Neurateles and Plectiscus and contrarily to the other genera of the Orthocentrus genus-group. It differs from Neurateles by the propodeum with distinct complete pleural and propodeal posterior transverse carinae ( Figure 4c). It differs from Plectiscus by the elongate and weakly sculptured metasoma, the ovipositor apically simple and longer than apical depth of abdomen ( Figure 5b), neither straight nor with dorsal subapical notch. Contrarily to most Plectiscus species from PNG (Villemant, Liu & Rousse in prep., see Figure 6), female also do not have sensillar areas on ventral face of median flagellomeres. The strong apical bristles bordering male hypopygium margin ( Figure 5a) also exists in some Stenomacrus species (G. Broad, com. pers.) but not in other genera. Finally and above all other characters, the facial depression of male is a unique feature. To our knowledge it is shared by no other Hymenoptera . Its structure and potential function are discussed below.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |