Terebellides atlantis Williams, 1984

Barroso, Maria, Moreira, Juan, Capa, Maria, Nygren, Arne & Parapar, Julio, 2022, A further step towards the characterisation of Terebellides (Annelida, Trichobranchidae) diversity in the Northeast Atlantic, with the description of a new species, ZooKeys 1132, pp. 85-126 : 85

Terebellides atlantis Williams, 1984

Figs 3C , 8 , 9 , 10C , 11 , 12

Terebellides atlantis Williams, 1984: 121-123, fig. 4, table 1.

Terebellides atlantis Species 16 - Nygren et al. 2018: 18-22, figs 6, 10.

Material examined.

15 specimens (Suppl. material 1), Barents Sea (ZMBN116454, ZMBN116455, ZMBN116458, ZMBN116459, ZMBN116460, ZMBN116462, ZMBN116463, ZMBN116465, ZMBN116467, ZMBN116468, ZMBN116470, ZMBN116471, ZMBN116472, ZMBN116474); Norwegian coast (ZMBN116476).

GenBank accession numbers of material examined (COI).

MG025258, MG025259, MG025260, MG025261, MG025262, MG025263, MG025264, MG025265, MG025266, MG025267, MG025268, MG025269, MG025270, MG025271, MG025272, MG025273, MG025274, MG025275, MG025276, MG025277, MG025278, MG025279, MG025280, MG025281, MG025282, MG025283, MG025284, MG025285, MG025286, MG025287, MG025288, MG025289, MG025290, MG025291, MG025292, MG025293, MG025294, MG025295, MG025296, MG025297, MG025298, MG025299, MG025300, MG025301, MG025302, MG025303, MG025304, MG025305, MG025306, MG025307, MG025308, MG025309, MG025310, MG025311, MG025312 .

Diagnostic features of studied material.

Complete individuals ranging from 10.0-16.0 mm in length (Fig. 9 ). Branchial dorsal lobes lamellae provided with well-developed papillary projections and branchial ventral lobes (Fig. 8A, B ) provided with long filaments (sometimes broken), 175.0 µm in length. Between 10-11 lamellae on dorsal lobes. Lateral lappets present on TC 1-4; dorsal projection of thoracic notopodia on TC 2-4 (Fig. 8A ). Geniculate chaetae in TC 5, acutely bent, with well-defined capitium (Fig. 8C ). Ciliated papilla dorsal to thoracic notopodia not observed. From TC 7, neuropodia with one row of type 3 thoracic uncini per torus, with rostrum/capitium length ratio of ~ 2:1 and capitium with a first row of three or four medium-sized teeth, followed by several smaller teeth (Fig. 8D ). Abdomen with 23-28 pairs of neuropodia with type 2 uncini (Fig. 8E, F ).

Colour pattern.

MG staining pattern characterised by compact green colourant in SG 1-6, J-shaped glandular region in SG 3-5 and striped pattern in SG 7-14 (Fig. 12 ). Similar to pattern 9.

Nucleotide diagnostic features.

All sequences of Terebellides atlantis share and are distinguished from other available Terebellides sequences in unique combinations of nucleotides (underlined) at the given position of our alignment: 60-84: TATTCGTATTGAGCTAGGGCAACCT, 132-150: ACATGCATTTTTAATAATC, 171-189: TTTTATTGGTGGATTTGGT, 213-231: GGGAGCTCCTGATATAGCC, 264-294: ACTACCACCAGCCTTAATCTTATTAGTAAGC, 345-363: ATTATCTGATAATATGGCT, 384-399: CCTTGCTATTTTTTCA, 477-484: GCTACGAC, 549-573: TCCAGTCTTAGCTGGTGCAATCACT, 558-591: CCGT, 615-630: TCCAGCTGGTGGTGGT.

Type locality.

Atlantic Ocean, off New England, 39°56.5'N, 70°39.9'W ( Williams 1984).

Distribution and bathymetry.

Barents Sea, Greenland Sea, South Iceland, Norwegian coast and shelf; 219-2750 m deep (Figs 10C , 11 , Suppl. material 1).

Remarks.

Terebellides atlantis is a small species, reaching up to 16 mm in length. It is characterised by the lack of papillae on margins of branchial lamellae, and by having branchiae of type 3 and filaments in ventral branchial lobes, thoracic uncini of type 3 and abdominal uncini of type 2 (Table 1 ). The most similar species to T. atlantis are T. shetlandica and T. lavesquei sp. nov. but T. atlantis differs from the latter in the size and type of branchiae (see remarks for T. lavesquei sp. nov. above). Branchial lobes are often missing as previously highlighted by Parapar et al. (2011). Finally, T. atlantis has the widest geographical distribution and depth range (219 to 2750 m) among Group B species.

Figures

Figure 3. STM photographs of several Terebellides species (A, C-F non-type specimens) A Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016 (species 1; ZMBN 116186) B Terebellides lavesquei sp. nov. (species 5; holotype, ZMBN 116322) C Terebellides atlantis Williams, 1984 (species 16; ZMBN 116472) D Terebellides irinae Gagaev, 2009 (species 24; ZMBN 116498) E Terebellides williamsae Jirkov, 1989 (species 2; ZMBN 116269) F Terebellides gracilis Malm, 1874 (species 3; ZMBN 116283). Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; bvl - branchial ventral lobe; ooc - oocytes; wTC - white thoracic chaetiger.

Figure 8. Terebellides atlantis Williams, 1984 (species 16; non-type specimens, ZMBN 116454 and ZMBN 116459), SEM micrographs A anterior end, left lateral view B branchiae, detail C TC 6 (TU 1), geniculate chaetae D thoracic uncini E abdominal neuropodium F abdominal uncini. Abbreviations: bf - branchial filament; bvl - branchial ventral lobe; cap - capitium; dpn - dorsal projection of notopodium; TC - thoracic chaetiger; TU - thoracic unciniger.

Figure 9. Relationship between number of abdominal chaetigers and body length (complete specimens considered except for T. irinae).

Figure 10. Geographic distribution of species of Terebellides in Northeast Atlantic Ocean A Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016 B Terebellides lavesquei sp. nov. C Terebellides atlantis Williams, 1984 D Terebellides irinae Gagaev, 2009 E Terebellides williamsae Jirkov, 1989 F Terebellides gracilis Malm, 1874. Pink star denotes the type locality of each taxon.

Figure 11. Bathymetric distribution of Terebellides species studied in this work.

Figure 12. Body MG staining patterns in ventral view of Terebellides species. Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016, Terebellides lavesquei sp. nov., Terebellides atlantis Williams, 1984, Terebellides irinae Gagaev, 2009, Terebellides williamsae Jirkov, 1989 and Terebellides gracilis Malm, 1874. Segments indicated in Arabic numbers.