Oxyporus
publication ID |
https://doi.org/ 10.1163/18759866-BJA10020 |
persistent identifier |
https://treatment.plazi.org/id/03B2D902-FFCB-FFCB-EF02-839EFB7D3334 |
treatment provided by |
Felipe |
scientific name |
Oxyporus |
status |
|
Oxyporus View in CoL collected by AT and AS in the Czech and HCO2198 (5’–TAAACTTCAGGGTGA- Republic and in Russia ( table 1). Barcodes CAAAAAATCA–3’) was used to amplify a for other 30 specimens were taken from the 658 bp fragment of the CO1 gene (Folmer et recently published paper on Korean Oxyporus al., 1994). The thermal cycling program con-
(Lee et al., 2020). A single CO1 sequence of sisted of 35 cycles of 94°C for 30 sec, 42°C for
O. (O.) maxillosus used by Lee et al. (2020) 30 sec and 72°C for 45 sec, followed by a final in their analysis, when checked by us via the extension at 72°C for 10 min. Paired forward BLASTn algorithm, turned out to have 100% and reverse reads were assembled and edited similarity with the barcode of Microcara tes- in Geneious (v. 9.1). Amplified fragments tacea Linnaeus, 1767 ( Scirtidae ) and thus is were sent for sequencing to the “Molecular not included in our research. Six additional and Cell Technologies” resource center (St.
specimens from the CNC were sequenced Petersburg State University) or to Evrogen Inc.
separately (see below) and uploaded to BOLD (Moscow). Additional specimens were sent Systems ( table 1). Finally, barcodes for yet to the Biodiversity Institute of Ontario ( BIO) another 17 specimens were taken from online ( Guelph , Ontario, Canada) for extraction, databases, namely BOLD Systems (https:// amplification and sequencing.
v3.boldsystems.org/index.php/TaxBrowser_ Assembled sequences were checked via Home) and GenBank NCBI (https://www. BLAST (https://blast.ncbi.nlm.nih.gov/Blast.
ncbi.nlm.nih.gov/nucleotide/). The sampling cgi) to verify their identity and were aligned largely covers the morphological diversity with CO1 fragments of Oxyporus (Oxyporus)
of the genus across the entire territory of rufus and O. (O.) maxillosus from NCBI.
Russia and adjacent areas. Barcodes for out- Sequences were aligned in Geneious 9.1 using group taxa Lordithon fungicola Campbell, MAFFT v. 7.450 ( Katoh and Standley, 2013)
1982 ( Tachyporinae ), Philonthus tenuicornis under the most rigorous L-INS-i strategy (see Mulsant & Rey, 1853, and Ontholestes murinus alignment in supplementary material S3).
Linnaeus, 1758 ( Staphylininae ) were taken The sequences were uploaded to Genbank from BOLD Systems. (https://www.ncbi.nlm.nih.gov/genbank/).
The accession numbers for all species used in
DNA extraction, PCR amplification, our analysis are given in table 1.
sequencing, and alignment
Total DNA was extracted from beetle legs Microscopy and illustrations using the Qiagen DNeasy Blood & Tissue Kit All photos of beetles were taken using a Nikon with the standard protocol (https://www.qia- SMZ 1500 stereomicroscope equipped with a gen.com/us/resources). Samples were incu- Nikon D700 digital SLR camera. Photos of genbated at 56°C in 180 µl of ATL buffer with 20 italia were taken either using a Leica M205C
µl of proteinase K added afterwards for about stereomicroscope equipped with a Canon
24 h. PCR was performed using Evrogen kit EMS 6D camera (images stacked with Zerene for Master Mix (https://evrogen.ru/prod- Stacker 1.04 (Zerene Systems, Richland, WA, ucts/PCR-kits/PCR-kits-polymerases/): 0,1 µl USA) or using a Leica M205C stereomicro-
Taq polymerase in a 25 µl reaction mixture scope equipped with a Leica DFC495 camera containing 1 µl of each primer, 2 µl dNTPs, (images stacked with Helicon Focus 6.2.2).
2.5 µl of Taq Buffer and 2 µl of genomic Drawings of genitalia structures were made
DNA template. The primer pair LCO1490 with a Leica DM 2500 microscope equipped (5’–GGTCAACAAATCATAAAGATATTGG–3’) with a camera Downloaded lucida from. All Brill illustrations.com 12/12/2023 were 04:19:55PM via Open Access. This is an open access article distributed under the terms of the CC-BY 4.0 license. https://creativecommons.org/licenses/by/4.0/
BIO |
University of the Basque Country |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.