Carlogonus gayathri, Sankaran & Sebastian, 2020

Sankaran, Pradeep M. & Sebastian, Pothalil A., 2020, A new species of Carlogonus Demange, 1961 from southern India (Spirostreptida Harpagophoridae, Harpagophorinae), with phylogenetic analysis and speciesgroup divisions in the genus, Zootaxa 4868 (1), pp. 27-40 : 30-38

Carlogonus gayathri sp. nov.

Figs 1–7 , 9

Type material. Holotype: Male (MILLI-ADSH0012), INDIA, Kerala: Palakkad, Thrippalur , Pullodu , 10°38’16.58’’N, 76°33’52.87’’E, 70 m alt., 23 October 2017, M.S. Pradeep leg., from ground, by hand . Paratypes 3 males, 9 females (MILLI-ADSH0013), same data as holotype except for the collecting date of 3 paratype females (11 November 2019).

Etymology. The specific epithet refers to the name of the Gayathripuzha River, one of the main tributaries of Bharathapuzha River, flowing through the Palakkad district on the bank of which the type locality (Thrippalur) of the new species lies.

Diagnosis. Within the exaratus -group, C. gayathri sp. nov. is most similar to C. subvalidus as both have an antero-mesal hook-like process of the anterior coxal fold, a sharply curved tibial spine and a distally twisted telopodite, but both can be separated from one another by the following combination of characters: lateral margin of anterior coxal fold without a spine-like outgrowth (lateral margin of anterior coxal fold of C. subvalidus with a spine-like outgrowth), narrow lateral flat process of the posterior coxal fold ( C. subvalidus with a wide lateral flat process of the posterior coxal fold) and a femoral spine without basal twists (femoral spine of C. subvalidus has basal twists) (compare Figs 5A, B, D , 7A, B , F–H with Carl 1941: figs 144–147 and herein Fig. 8G ).

Description. Measurements: male with 65 body rings (64 podous and 1 apodous (telson)), circa 127 mm long, 6.4 mm wide. Female with 66 body rings (65 podous, 1 apodous), circa 133 mm long, 7.9 mm wide.

Colour. Head, collum yellowish with broad coffee-brown patches on both. Antennae, anal valves, legs coffeebrown. Clypeal margin with a coffee-brown, serration-like pattern ( Fig. 3F ). Body rings coffee-brown, baso-laterally with yellowish patch. Posterior margin of metazonae light brown. Metazonae up to ring 64 dorso-laterally with olive-green transverse patch. Preanal process (anal spine) yellowish. Colouration of preserved material: overall dull brown with greyish patches and stripes; parts with yellowish colour faded to straw-colour. Metazonae lose dark olive-green colouration.

Head. Head smooth. Each eye patch with circa 55–59 ommatidia arranged in 7 or 8 horizontal rows. Axial sulcus prominent, reaching up to frons. Labrum with three smoothly rounded teeth and a single row of 6 or 8 short labral setae ( Fig. 3F ). Clypeus with six setiferous foveolae, three on each side ( Fig. 3F , arrows 3–8). Antennal cavity present, nearly circular in outline. Antennae moderately long ( Fig. 3G ), protruding back to ring 4. Relative length of antennomeres: 1<2>3>4<5>6. Terminal antennomere (disc) with four large sensory cones located together inside a membranous area ( Fig. 4A ). Antennomere 6 apico-laterally with field of 9 or 10 rows of narrow, long sensilla basiconica, disc laterally with 1 or 3 rows of irregularly clustered tiny sensilla basiconica ( Figs 4 A–C, arrows 1 and 2 respectively).

Gnathochilarium. Usual for spirostreptideans ( Fig. 3D ). Mentum smooth with more or less straight posterior margin with less developed prebasilare ( Fig. 3D , arrow 1). Hypostoma flat, medially smooth, laterally with oblique striations. Lamellae linguales each with five spine-like setae, two proximally, three distally. Stipites with a slightly wavy lateral margin, with disto-ventral bulging, medially with oblique excavation, each with a short, thick, thornlike disto-ventral seta placed on a small conical mount, each with four stout apico-lateral setae ( Fig. 3D ), with 11 or 12 short basal spine-like setae. Only 1st pair of palpi with numerous sensilla ( Fig. 4E ). Hypopharyngeal crest with weakly developed field of spine-like structures, distally with a membranous lamina bearing a series of short marginal setae ( Fig. 4E ). Central pads of endochilarium divided to a short distance by a groove and a ridge into two separate regions ( Fig. 4E ; CP, Endo).

Mandible. Stout and short. External tooth simple, elongately triangular ( Fig. 4F ; ET); inner tooth with four cusps ( Fig. 4F; 4 IT). Nine or 11 rows of pectinate lamellae ( Fig. 4F ; PL). Medio-basal margin of pectinate area smooth ( Fig. 4F ); basal margin with 3 or 4 transverse rows of small spines. Molar plate long with a distal excavation ( Fig. 4F , arrow 3; MP).

Collum. Lateral margin rounded, extending beyond the tips of ring 2, surface smooth ( Fig. 3A, E, M ).

Body rings. Divided by sutures in two transverse zones, pro- and metazonae. Pro- and metazonae dorsally micropunctuated, ventrally with numerous weak longitudinal striations. Ozopore located on metazona, starting with ring 6, located close to, but not touching the suture between pro- and metazonae. Preanal ring/epiproct sharp-edged, extending beyond the anal valves/paraprocts as a long, smooth claw-like preanal process slightly curved downwards ( Fig. 3C, N ). Anal valves with well developed lips, but with neither micropunctuations, grooves, nor setae. Subanal scale/hypoproct, small, widely triangular.

Legs. Coxae 1 short, subcylindrical, coxae 2 rectangular in outline, fused together ( Fig. 3 H–I, O–P); coxae 3 and 4 elongately triangular, fused ( Fig. 3J, Q ); others stout, broadly triangular, unfused. Prefemur 1 and 2 moder- ately long, subcylindrical, unfused ( Fig. 3 H–I, O–P). Leg-pair 2 longer than 1 ( Fig. 3I ); each podomere with apical/ventral/dorsal/mesal/lateral tiny, stout and slender setae; postfemur and tibia from leg-pair 3 onwards bear well developed, complete pads; in anterior leg-pairs, pads with tip curved down ( Fig. 3K ). Length of mid-body legs circa 5.7 mm in males, circa 5.1 mm in females. Claw large, slightly curved ( Fig. 3K ).

Male sexual characters. Podomeres lack modifications ( Fig. 3 H–J). Only body ring 7 conspicuously enlarged ( Fig. 3A ). Tips of gonopods visible in lateral view ( Fig. 3A ).

Penis. Short, bluntly triangular with thin, flat apical part ( Fig. 3I, L , arrow 2).

Gonopods ( Figs 5 A–D, 7A–I). Anterior coxal fold ( Figs 5A , 7A ; AC): lateral margin less modified, with a weak indentation ( Figs 5A , 7A , arrow 1); antero-mesally with a thumb-like and a hook-like processes, antero-laterally with a short process ( Fig. 7A ; amtAC, amhpAC, alpAC). Posterior coxal fold ( Fig. 7C ; PC): basally with moderately high lateral paracoxites, distally flat to accommodate telopodite ( Fig. 7 A–B, D; PX); internal mesal fold with antero-mesal wide process ( Fig. 7E ; imPC); baso-laterally with a mount-like process lying near to the basal part of telopodite, distally with an anterior roughly globular and a lateral flat processes ( Fig. 7 B–C; blpPC, apPC, lpPC). Telopodite ( Figs 5D , 7B , F–I; T): flat resting on paracoxite, with ventral and lateral twists ( Figs 5D , 7B ); femur with a single strong femoral spine having abrupt basal and smooth distal curvatures ( Figs 5D , 7B , F–G; FS); tibial spine long, slender, smoothly curved with a basal apically bifurcated seta-like side branch ( Fig. 7B, D , G–H, arrow 2; TS); palette wide, flat, narrowing towards tip, dorsally with a longitudinal crest, with a short lateral thorn-like process, with a single dorsal row of more than 10 pale, brownish apically bifurcated blepharochaetae ( Fig. 7 H–I; P, C, dtpP, B).

Female copulatory organ (vulva) ( Fig. 6 A–G). Located in membranous pouches attached to coxae 2 and 3 and to the inner lateral margin of ring 1 ( Fig. 6A , arrows 1 and 2). Simple, looking like a rose flower bud ( Fig. 6 B–D), consisting of two simple, subequally-sized, moderately sclerotised valves: a large aboral valve covering the oral valve, with lateral longitudinal invagination, with an antero-lateral membranous extension to attach with the inner margin of ring 1, with ventro-lateral ridges internally ( Fig. 6E, G , arrow 5). Oral valve short, being covered by meso-lateral part of aboral valve, externally with tiny thorn-like processes and ridges ( Fig. 6 E–F, arrow 4). No valval setae.

Natural history. Carlogonus gayathri sp. nov. is living in open grounds covered with dried leaves and debris. It can be seen during the onset of the rainy season. Rarely it could be observed crawling inside buildings (Sankaran, pers. obs.).

Barcode. Partial barcode, positions 1490–2198 of the standard barcode: CAAAAAATCAGAATAAGTGTTGGTATAAAATAGGGTCTCCTCCACCAGCAGGGTCAAAGAAAGAATAT- TAAAATTTCGGTCAGTAAGTAATATTGTGATAGCTCCGGCTAGCACTGGCAAAGATAGTAAAGGAGA- ATGGCTGTAATTTTTACAGCTCATACGAAAAGGGGTATTTGTTCGAATAATATACCTGCTGTTCG- TATATTAATGATGGTTGTAATGAGTTGATTGCACCTAGGATTGATGAAGCACCTGCTAAATGTAAAGAAAAAATAGC- TATATCTACTGATGGGCCGGTATGTGCTAAGGTGGAAGCTAAAGGAGGGTAAACGGTTCAACCT- G TA C C A G C T C C T T T T T C TA C G G C T G A A G A G G C TA G TA ATA G G A ATA A G G C A G G G G G G A G - CAATCAAAAGCTTATATTATTTATTCGAGGGAAGGCTATATCTGGGGCACCTAATATAAGGGGGACTAGT- CAATTTCCGAAACCACCAATTATAATTGGTATTACTATAAAGAAAATTATTACAAAAGCGTGGGCTGT- TACGATTACATTATAAATTTGATCGTCTCCAATTAAGCTGCCAGGTTGGCTTAATTCTAAGCGGATTA- ATATACTTAAAGAGGATCCAACTAATGCTGCTCAAGCACCAAAAATTAAATATATAGTTCCAATATCTTTAT

GenBank accession number. The GenBank accession number of the ORF region (positions 292–462) of the new sequence is MN887639 .

Phylogeny. Phylogenetic analysis shows that Carlogonus is the sister-taxon to Thyropygus , with Anurostreptus in a basal position ( Fig. 1 ).

Note. A broken femoral spine was found in the left vulva of one of the female specimens of C. gayathri sp. nov. ( Fig. 6B , arrow 3). One male with a broken-off femoral spine on the left telopodite was also found. The occurrence of a broken femoral spine in the vulva may indicate its use as an accessory copulatory structure. It can be hypothesised that during copulation, the male C. gayathri sp. nov. (and possibly the males of other known Carlogonus species) may use the femoral spine to keep the valves of the vulva open in order to support the insertion of the telopodite.

Figures

FIGURE 1. Phylogenetic relationship of Carlogonus Demange, 1961 using maximum likelihood analysis (ML) and Bayesian Inference (BI) showing that Carlogonus is sister-taxon to Thyropygus Pocock, 1894 with strong support (99% for ML bootstrap replicates and a BI posterior probability of 0.99).

FIGURE 2. Field photographs of Carlogonus gayathri sp. nov.. A: Male from Pullodu in Trippalur, Palakkad (MILLI- ADSH0012). B: Female from Pullodu in Trippalur, Palakkad (MILLI-ADSH0013). Photo courtesy Jimmy Paul.

FIGURE 3. Carlogonus gayathri sp. nov.. A, M: Head and anterior trunk segments, lateral view. B: Legs 1–7, ventral view. C, N: Telson, lateral view. D: Gnathochilarium, ventral view. E: Collum, lateral view. H, O: Leg-pair 1, ventral view. I, P: Leg-pair 2, dorsal and ventral views respectively. J, Q: Leg-pair 3, ventral and dorsal views respectively. F: Head, frontal view showing teeth and setiferous foveolae. G: Left antenna, lateral view. K: Left leg of leg-pair 3 showing pads, dorsal view. L: Penis, ventral view. A–L male, M–Q female. Scale bars: A–C, M–N, O–Q = 2 mm; D, G–J = 1 mm; E–F, K = 0.5 mm; L = 0.2 mm.

FIGURE 4. Carlogonus gayathri sp. nov., male. A: Left antenna, antennomere 6 and disc, apical view. B: Enlarged view of sensilla basiconica on antennomere 6, apical view. C: Enlarged view of sensilla basiconica on disc, apical view. D: Gnathochilarium, dorsal view. E: Central pads and palps, detail. F: Left mandible, inner view. Abbreviations: 4IT = 4-combed inner tooth, CP = central pad, Endo = endochilarium, ET = external tooth, MP = molar plate, PL = pectinate lamellae. Arrows indicate sensilla basiconica on antennomere 6 and disc (1, 2) and distal excavation on molar plate (3). Digits 1, 2, 3 and 4 indicate 4 combs of inner tooth. Scale bars: A = 0.1 mm; B–C = 0.02 mm; D = 0.5 mm; E–F = 0.2 mm.

FIGURE 5. Carlogonus gayathri sp. nov.. A: Gonopods, ventral view. B: Same, dorsal view. C: Same, lateral view. D: Left telopodite, ventral view. Scale bars: A–D = 1 mm.

FIGURE 6. Carlogonus gayathri sp. nov.. A: Female ring 3 showing vulvae, caudal view. B: Vulva, lateral view. C: Same, mesal view. D: Same, ventral view. E: Extended vulva showing external thorn-like processes and ridges on oral valve and internal ventro-lateral ridges on aboral valve, ventral view. F: Enlarged view of thorn-like processes and ridges on oral valve, ventral view. G: Enlarged view of ridges on aboral valve, ventral view. Arrows indicate vulvae in female ring 3 (1, 2), broken femoral spine in vulva (3), thorn-like processes and ridges on oral valve (4) and internal ventro-lateral ridges on aboral valve (5). Scale bars: A = 2 mm; B–E = 1 mm; F–G = 0.2 mm.

FIGURE 7. Carlogonus gayathri sp. nov., male. A: Gonopods, ventral view. B: Same, dorsal view. C: Right gonopod after removing telopodite, dorsal view. D: Left gonopod, lateral view. E: Same, mesal view. F: Left telopodite, ventral view. G: Same, lateral view. H: Enlarged view of distal part of left telopodite, mesal view. I: Enlarged view of blepharochaetae, lateral view. Abbreviations: alpAC = antero-lateral process of anterior coxal fold, amhpAC = antero-mesal hook-like process of anterior coxal fold, amtAC = antero-mesal thumb-like process of anterior coxal fold, AC = anterior coxal fold, B = blepharochaetae, C = distal longitudinal crest, F = femur, FS = femoral spine, dtpP = distal thorne-like process of palette, P = palette, apPC = apical process of posterior coxal fold, blpPC = baso-lateral process of posterior coxal fold, imPC = internal mesal fold of posterior coxal fold, lpPC = lateral process of posterior coxal fold, mpPC = mesal process of posterior coxal fold, PC = posterior coxal fold, PX = paracoxite, ST = sternite, T = telopodite, TS = tibial spine, TT = tibiotarsus. Arrows indicate indentation on lateral margin of anterior coxal fold (1) and basal bifurcated seta on tibial spine (2). Scale bars: A–G = 1 mm; H–I = 0.5 mm.

FIGURE 8. Previously known Carlogonus spp.. A: Carlogonus acifer Demange, 1977. B: Carlogonus auriculus Demange, 1983. C: Carlogonus chowdaiahi Demange, 1977. D: Carlogonus exaratus (Attems, 1936). E: Carlogonus palmatus Demange, 1977. F: Carlogonus robustior (Attems, 1936). G: Carlogonus subvalidus (Carl, 1941). H: Carlogonus verhoeffi Demange, 1981 (figures reproduced from Attems (1936), Carl (1941), Demange (1977a, b; 1981; 1983)).

FIGURE 9. Currently known distribution records of Carlogonus spp.. * Carlogonus acifer Demange, 1977, ♦ Carlogonus auriculus Demange, 1983, é Carlogonus chowdaiahi Demange, 1977, ■ Carlogonus exaratus (Attems, 1936), r Carlogonus gayathri sp. nov., ● Carlogonus palmatus Demange, 1977, □ Carlogonus robustior (Attems, 1936), ○ Carlogonus subvalidus (Carl, 1941), ▲ Carlogonus verhoeffi Demange, 1981 (record of Carlogonus spinicaudus (Gervais, 1847) and subsequent records of other species are omitted from the map due to the lack of locality details).