Dipturus argentinensis, Astarloa, Juan Martin Díaz De, Mabragaña, Ezequiel & Hanner, Robert, 2008

Astarloa, Juan Martin Díaz De, Mabragaña, Ezequiel & Hanner, Robert, 2008, Morphological and molecular evidence for a new species of longnose skate (Rajiformes: Rajidae: Dipturus) from Argentinean waters based on DNA barcoding, Zootaxa 1921, pp. 35-46 : 37-41

Dipturus argentinensis n. sp.

( Figure 1 , Table 1 )

Holotype.— INIDEP 793, 765 mm TL, juvenile male, off central Patagonian continental shelf, 45º38’S, 64º08’W, 98 m, 21 January 2006, R/V DR. EDUARDO HOLMBERG, cruise H-01/06, sta. 38. GenBank Accession No. EU074410 .

Paratypes.— INIDEP 794, 935 mm TL, female, 46° 20´S, 64° 09´W, 95 m, 0 3 September 2002, R/V DR. EDUARDO HOLMBERG, cruise H-04/02, sta. 363. INIDEP 795, 632 mm TL, immature female, off south Patagonian continental shelf, 50º 15’ S, 63º 35’ W, 140 m, 14 February 2006, R/V DR. EDUARDO HOLMBERG, cruise H-02/06, sta. 28. GenBank Accession No. EU074411 . INIDEP 796, 710 mm TL, immature male, off south Patagonian continental shelf, 47º 45’ S, 61º 28’ W, 142 m, 21 February 2005, R/V DR. EDUARDO HOLMBERG, cruise H-02/05, sta. 45. INIDEP 797, 617 mm TL, immature male, off south Patagonian continental shelf, 45º 18’ S, 64º 40’ W, 87 m, 20 January 2005, R/V DR. EDUARDO HOLMBERG, cruise H-01/05, sta. 34. INIDEP 798, 555 mm TL, immature male, off south Patagonian continental shelf, 45º 47’ S, 64º 47’ W, 96 m, 19 January 2006, R/V DR. EDUARDO HOLMBERG, cruise H-01/06, sta. 26. GenBank Accession No. EU074409 . INIDEP 799, 403 mm TL, immature male, off south Patagonian continental shelf, 46º 03’ S, 66º 46’ W, 91 m, 15 January 2006, R/V DR. EDUARDO HOLMBERG, cruise H-01/06, sta. 7. GenBank Accession No. EU074405 . INIDEP 800, 690 mm TL, immature male, off south Patagonian continental shelf, 45º 54’ S, 63º 10’ W, 97 m, 16 January 2005, R/V DR. EDUARDO HOLMBERG, cruise H-01/05, sta. 13. GenBank Accession No. EU074406 . INIDEP 802, 522 mm TL, immature female, off south Patagonian continental shelf, 45º 54’ S, 63º 10’ W, 97 m, 16 January 2005, R/V DR. EDUARDO HOLMBERG, cruise H-01/05, sta. 13. GenBank Accession No. EU074408 . INIDEP 803, 670 mm TL, immature female, off south Patagonian continental shelf, 45º 54’ S, 63º 10’ W, 97 m, 16 January 2005, R/V DR. EDUARDO HOLMBERG, cruise H-01/05, sta. 13. GenBank Accession No. EU074407 .

Diagnosis. Dipturus argentinensis is characterized by the combination of the following characters: dorsal surface of disc brown purplish with no distinct ocelli or blotches margined with dark brown on pectoral and pelvic fins. Upper surface of disc smooth except few small spinules scattered on tip of snout. Ocular thorns present, with scapular thorns absent. A single nuchal thorn either present or absent. One median row of 10 to 24 small caudal thorns. Dorsal and caudal fins scattered with very few spinules. One or two interdorsal thorns. Relatively long and thin tail, approximately half the total length. Ventral surface of disc as dark as the upper side, smooth except few small spinules scattered on tip of snout. Interbranchial space with no prickles.

Description. Measurements and counts are given in Table 1 . Differing values of the paratypes following those for the holotype are in parentheses. Disc rhombic, 1.24 times as broad as long (1.22-1.27); snout greatly elongated, 4.35 times in total length (4.54 to 5.26); Anterior margin of disc concave and posterior margin convex with rounded inner corner to level of pelvic fins. Orbit length 0.62 times (0.5 – 0.66) of interorbital length and 1.09 times spiracle length (1.14–1.58). Distance between spiracles 1.18 times that between orbits (1.16 – 1.36). Preorbital length 4.49 times (3.88 to 4.33) interorbital width. Tail very slender and relatively long with a thin lateral tail fold. Its length from center of cloaca to tip 0.82 times that from tip of snout to center of cloaca (0.84 to 0.95). Space between dorsal fins, 0.28 times (0.19–0.38) base of first dorsal fin. Height of dorsal fins greater than half their bases’ lengths. Preoral length 2.79 times mouth width (2.36 to 2.75). Preorbital length 7.29 times orbit length (6.24 to 7.88). Nostril flaps are short, thick and tube -like. Anterior nasal flap (nasal curtain) well developed and fringed along distal margin. Posterior nasal flap poorly developed and smooth. Mouth slightly arched. Upper and lower jaws with 37 and 38 (35 to 40, and 34 to 43) tooth rows, respectively. Distance between first gill slits 1.86 times distance between nares (1.71 to 1.91). Distance between fifth gill slits 1.06 times internarial distance (1.03 to 1.28). First dorsal fin about equal in size and shape to second dorsal fin. Dorsal side of disc smooth except few small spinules scattered on tip of snout (in one specimen the spinules also placed on both sides of eyes as well as in front of ocular region). Ventral side of disc, pelvics, claspers and tail without dermal denticles except few small spinules scattered on tip of snout. Midline of tail with 13 (10 to 24) small thorns, with oval bases and backwardly directed crowns.

Coloration when fresh. Upper surface of disc plain purplish brown and margined with dark brown on pectoral and pelvic fins with no distinct ocelli or blotches. Thorns marked off pale milky-white pigment. Lateral tail folds creamy white pigment. Dorsal fins uniformly brown.

Lower surface of the disc brownish on central part, becoming pale brown to outer parts of pectoral fins and with darker margins. Anterior lobes of pelvic fins dark brown whereas posterior ones are lighter and narrowly edged grey. Underside of tail uniformly brown with light margins at level of dorsal fins.

Etymology. The specific epitet argentinensis is named in reference to the Argentine Sea where the type material was collected.

Common name. New English name: Argentine Skate; new Spanish name: Raya hocicuda de cola larga.

Barcode sequence. A 651 base pair amplicon from the 5´region of the mitochondrial COI gene was bidirectionally sequenced for the holotype and six paratypes (GenBank accession numbers EU074410 , EU074405 , EU074406 , EU074407 , EU074408 , EU074409 , EU074411 , respectively). The holotype and five of the paratype sequences were virtually identical, while the seventh differed by only a single nucleotide (0.146 % sequence divergence). The mtDNA COI barcode profile of the holotype is reported herein as an aspect of the type description:

CCTTTACTTAATTTTTGGTGCCTGAGCAGGCATGGTCGGGACTGGCCTAAGTCTTTTAATCCGAGC AGAACTAAGTCAACCCGGGACCCTCCTGGGTGACGATCAGATTTATAATGTCATTGTTACAGCCCA TGCCTTTGTAATAATCTTTTTTATGGTTATACCAATTATAATCGGCGGGTTTGGTAATTGACTCGTCC CTTTAATAATTGGCTCCCCCGACATGGCCTTCCCACGCATAAATAACATAAGTTTCTGACTTTTACC CCCCTCTTTTCTCCTCCTCCTGGCCTCCGCTGGAGTTGAGGCCGGGGCCGGAACAGGTTGAACTG TCTACCCCCCTCTGGCAGGAAATCTGGCCCACGCGGGGGCCTCCGTAGACTTAACAATTTTCTCT CTTCACTTGGCAGGTGTTTCATCTATTCTAGCCTCCATTAACTTCATCACCACAATTATTAACATAA AACCACCAGCAATCTCTCAATACCAGACACCCTTATTCGTGTGATCAATTCTTGTTACAACTGTTTT ACTTCTTATGGCCCTCCCAGTTCTAGCAGCCGGCATCACTATACTACTCACGGACCGTAATCTCAA CACAACTTTCTTTGACCCGGCTGGAGGGGGCGACCCCATTCTATACCAACACTT

Details of the individuals sequenced along with those congeneric species for making comparisons are provided in Table 2 .

Figures

FIGURE 1. Dipturus argentinensis n. sp., holotype, INIDEP 793, 765 mm TL, juvenile male, off central Patagonian shelf, Argentina. a – dorsal view; b – ventral view.

Tables

TABLE 1. Morphometrics (in mm) and meristics of the Holotype (INIDEP 793) and 9 paratypes of Dipturus argentinensis. Range and mean values expressed in % of total length, except total length and disc width in mm. SD = standard deviation.

		Paratypes
	Holotype	Range	Mean	SD
Total length	765	403–935
Disc width	572	297–683
Disc length	463	57.8–61.3	59.2	1.1
Snout length (preorbital)	175	19.1–22.4	20.8	1.0
Snout length (preoral)	173	19.3–23.7	21.5	1.5
Orbit diameter	24	2.7–3.2	3.0	0.2
Distance between orbits	39	4.5–5.4	5.0	0.3
Orbit and spiracle length	34	4.1–4.7	4.4	0.2
Spiracle length	22	1.9–2.6	2.2	0.3
Distance between spiracles	46	6.2–6.6	6.3	0.2
Mouth width	62	8.1–8.9	8.5	0.2
Distance between nostrils	67	8.1–9.2	8.7	0.3
Width: first gill openings	15	1.2–1.9	1.6	0.3
Width:second gill openings	16	1.4–2.1	1.8	0.2
Width: third gill openings	16	1.3–2.1	1.7	0.2
Width: fourth gill openings	15	1.3–2.2	1.8	0.3
Width: fifth gill openings	14	1.2–2.0	1.5	0.2
Distance: first gill openings	119	15.1–16.7	15.9	0.6
Distance: third gill openings	102	12.8–13.9	13.3	0.3
Distance: fifth gill openings	71	8.9–11.4	9.8	0.7
Height: 1st dorsal fin	27	3.4–4.1	3.7	0.3
Length: 1st dorsal fin base	43	5.0–6.5	5.9	0.5
Height: 2nd dorsal fin	27	2.9–4.0	3.5	0.4
Length: 2nd dorsal fin base	41	4.8–5.7	5.3	0.3
Height caudal fin	6	0.7–1.3	1.1	0.2
Length: caudal fin base	32	3.8–6.4	4.9	0.8
Interdorsal distance	12	1.2–2.3	1.5	0.4
Tail width at axil of pelvic fin	25	2.8–4.1	3.5	0.5
Anterior pelvic fin length	84	11.4–13.8	12.6	0.8
Distance: snout to 1st dorsal fin	18	1.5–2.7	1.9	0.8
Distance: snout to cloaca	420	51.4–54.5	52.9	0.9
Distance: cloaca to caudal tip	345	45.5–48.6	47.2	1.0
Distance: 2nd dorsal fin to caudal tip	35	4.6–17.6	7.7	4.4
Distance:cloaca to 1st dorsal fin	211	27.2–29.7	28.8	1.0
Distance:cloaca to 2nd dorsal fin	266	34.3–36.7	35.9	0.8
Inner side clasper length	36	3.7–4.1	4.0	0.2
Upper jaw tooth rows	37	35–40	37.6	1.7
Lower jaw tooth rows	38	34–43	37.8	3.1