Heliopetes (Heliopetes) lana Grishin, 2023
publication ID |
https://doi.org/10.5281/zenodo.10396362 |
persistent identifier |
https://treatment.plazi.org/id/03810139-FFF9-BB77-C0CA-FC6DE2F3B312 |
treatment provided by |
Felipe |
scientific name |
Heliopetes (Heliopetes) lana Grishin |
status |
sp. nov. |
Heliopetes (Heliopetes) lana Grishin , new species
https://zoobank.org/ 2E6992E1-9CAE-4FF2-AD84-B73CB2C57F00
( Fig. 3 part, 83–84, 302–303)
Definition and diagnosis. Phylogenetic analysis reveals that specimens from North America identified as Heliopetes alana (Reakirt, 1868) (type locality in Colombia, syntype sequenced as NVG-15039C04, sequence completeness insufficient to add it to the Z chromosome tree) are not monophyletic with it and instead are sister to both H. alana and Heliopetes chimbo Evans, 1953 (type locality in Ecuador), exhibiting notable genetic differentiation ( Fig. 3): e.g., COI barcodes of a specimen from Guatemala and Colombia differ by 2% (14 bp). All available names in synonymy with H. alana have type localities in South America. Therefore, the North American populations are a new species. This new species keys to H. alana (G.2.12) in Evans (1953) and differs from its relatives by the following combination of characters: typically whiter (i.e., less yellow), especially on ventral hindwing ( Fig. 84, but due to extensive variation hardly identifiable by facies), rounder in dorsal view anterior margin of tegumen, more extended harpe and, correspondingly, longer expansion of ampulla ( Fig. 302–303). Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly1079.16.3:T70C, aly173.27.12:C85T, aly173.27.12:A144G, aly276665.11.2:T224G, aly276665.11.2:A302T, and COI barcode: A229G, C235T, A289A, T397C, A477G, T557C.
Barcode sequence of the holotype. Sample NVG-17109G07, GenBank OR837660, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCTTTAATT GGAGATGATCAAATTTATAATACTATTGTTACAGCCCATGCTTTTATTATAATTTTTTTCATAGTAATACCAATTATAATTGGAGGATTTGGAAATT GATTAGTACCTTTAATATTAGGAGCCCCAGATATGGCATTTCCTCGTATAAATAATATAAGATTTTGACTTTTACCCCCATCCCTAACATTATTAAT TTCAAGAAGTGTAGTAGAAAATGGAGCAGGAACTGGTTGAACAGTTTACCCCCCTCTCTCGGCTAATATTGCCCATCAAGGATCTTCTGTTGATTTA GCTATTTTCTCTTTACATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGTATTAGAAGTATATCAT TTGATCAAATACCTTTATTTGTATGAGCGGTAGGAATTACTGCTTTATTACTACTATTATCATTACCTGTTCTAGCAGGTGCCATTACAATATTATT AACAGATCGAAATTTAAATACATCATTCTTCGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTC
Type material. Holotype: ♂ deposited in the Los Angeles County Museum of Natural History, Los Angeles, CA, USA ( LACM), illustrated in Fig. 83–84, bears the following three rectangular labels, two white: [ GUATEMALA. Peten District | Finca Ixobel S of Poptun | 16° 18’ 14” N: 89° 25’ 20” W | 5-10 JUNE 2003: 1700 ft. | Ron Leuschner. coll.], [DNA sample ID: | NVG-17109G07 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Heliopetes | lana Grishin ] GoogleMaps . Paratypes: 2♂♂: 11-BOA-13383A02 the same data as the holotype [ USNM] and NVG-20062H06 Mexico: Tamaulipas, 1–4 km N of Gomez Farias, 350 m, 17-Aug-1972, C. J. Durden leg. (genitalia Fig. 302–303) [ TMMC].
Type locality. Guatemala: Peten District, Finca Ixobel S of Poptún, elevation 1700 ft, GPS 16.3039, −89.4222. Etymology. The name removes a negating “a” from the name of its more southern sister species H. alana and is a feminine noun in apposition.
Distribution. This species is currently known from Mexico and Guatemala but is expected from other Central American countries.
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
Genus |