Vernia clara Grishin, 2023

Zhang, Jing, Cong, Qian & Grishin, Nick V., 2023, Supplementary Materials and Appendix, Insecta Mundi 2023 (26), pp. 1-115 : 44

Vernia clara Grishin , new species

https://zoobank.org/ D20A8C16-E197-4F52-806F-01921EE16C07

( Fig. 4 part, 99–100, 322–323)

Definition and diagnosis. Genomic analysis of specimens from Mexico and Panama identified as Vernia dares ( Plötz, 1883) (type locality not specified) reveals that they differ significantly from the South American V. dares ( Fig. 4): e.g., COI barcodes differ by 5.8% (38 bp) and, therefore, this complex consists of at least two species. Although we were not able to locate primary type specimens, according to the original description ( Plötz 1883) and the illustration in Draudt (1921 –1924), which probably is a copy of an unpublished drawing by Plötz, V.dares is of a darker phenotype that corresponds to South American specimens. Therefore, North and Central American specimens that are characterized by more extensive yellow-orange coloration represent a new species. This new species keys to “ Pompeius dares ” (M.15.5) in Evans (1955), but differs from it by larger yellow-orange spots, more developed yellow-orange overscaling, and less contrasting dark spots on the ventral hindwing. Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly2487.24.2:T675G, aly2487.24.2:T765C, aly536.138.7:T78C, aly82.18.3:T303C, aly82.18.3:G321A, and COI barcode: T5C, 31C, T46C, T193C, A283T, T536C.

Barcode sequence of the holotype. Sample NVG-22035A08, GenBank OR837668, 658 base pairs: AACTCTATATTTTATTTTCGGTATTTGAGCCGGTATATTAGGAACCTCTCTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGTTCTTTAATT GGAGATGATCAAATTTATAATACTATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGGTTTGGAAACT GATTAGTCCCATTAATATTAGGAGCCCCTGACATAGCTTTCCCACGAATAAATAACATAAGATTTTGAATATTACCCCCATCTTTAACTCTTTTAAT CTCAAGTAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACTGTTTATCCTCCTTTATCATCAAATATTGCTCACCAAGGATCTTCTGTTGATTTA GCAATTTTTTCTCTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAACTTATCAT TTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCTTTATTACTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACAATATTACT TACTGATCGAAATTTAAACACTTCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTCTTTACCAACATCTTTTC

Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 99–100, bears the following three rectangular labels, two white: [ Panama: Chiriqui | Santa Cruz | 10.VIII.1975 | G.B. Small], [DNA sample ID: | NVG-22035A08 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Vernia | clara Grishin ]. Paratypes: 2♂♂ and 3♀♀: Mexico: 1♂ NVG-22102C01, CASENT 8566973 Nayarit, 20 air mi NE of San Blas, 23-Dec-1971, C. D. MacNeill leg. [ CAS]; 1♀ NVG-18021D01 San Luis Potosi, Valles, 10-Jun-1966, H. A. Freeman leg. [ AMNH]; Chiapas: 1♂ NVG-18115C04, USNMENT_01531564 35 mi W of Tuxtla Gutierrez, 16-Aug-1972, G. F. and S. Hevel leg. [ USNM]; 1♀ NVG-21044A02 3 mi S of Simojovel, 3000′, 22-Jun-1989, J. Kemner leg., genitalia SRS-4469 [ MGCL] and Panama: 1♀ NVG-18115C05, USNMENT_01531565 Panama, Cerro Campana, 2000 ′, GPS 8.6833, −79.9167, 9-Mar-1963, G. B. Small leg. [ USNM].

Type locality. Panama: Chiriquí Province, Santa Cruz.

Etymology. The name clara , which is Latin for bright and clear, is given for the brighter colors of this species. The name is an adjective.

Distribution. From Mexico to Panama.