Aguna esmeralda Grishin, 2023

Zhang, Jing, Cong, Qian & Grishin, Nick V., 2023, Supplementary Materials and Appendix, Insecta Mundi 2023 (26), pp. 1-115 : 15-16

Aguna esmeralda Grishin , new species

https://zoobank.org/ 81C0476E-A9A8-4A6E-8EE9-F25C3C13130F

( Fig. 1 part, 29–30, 241–242)

Definition and diagnosis. A species related to Aguna glaphyrus (Mabille, 1888) (type locality in Brazil: Santa Catarina ), Aguna longicauda Austin and O. Mielke, 1998 (type locality in Brazil: Rondônia), and Aguna spicata Austin and O. Mielke, 1998 (type locality in Brazil: Rondônia) ( Fig. 1), but genetically differs from them more than they are from each other, e.g., COI barcode difference from A. glaphyrus is 5% (33 bp). Phenotypically can be identified by the contrasting tint of upperside green overscaling: yellower on the forewing and bluer on the hindwing ( Fig. 29), short and stubby tails, nearly oval valva (when taken together with harpe), longer than in A. glaphyrus and A. spicata (among others), and separated from harpe only with a small notch, harpe rounded distad rather than narrowing, sacculus expanded distad. Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly671.26.9:C88T, aly671.16.4:T181A, aly 1468.8.8:A146G, aly 1468.8.8:T156C, aly 1340.1.1:C1566T, and COI barcode: A148G, A181T, TC208, T430G, T523C.

Barcode sequence of the holotype. Sample NVG-18017A03, GenBank OR837634, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCATTAAGATTACTTATTCGAACTGAATTAGGAACCCCCGGATCTTTAATT GGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATGATTTTTTTTATAGTAATACCTATTATAATTGGTGGATTTGGAAATT GACTTGTACCTCTCATACTAGGAGCCCCTGATATAGCATTCCCCCGAATAAATAATATAAGATTTTGACTTTTACCCCCCTCCTTAACTCTTTTAAT CTCTAGAAGCATTGTAGAAAATGGTGCAGGCACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGCACATCAGGGAGCTTCCGTAGATTTA GCAATTTTTTCTTTACATTTAGCAGGAATTTCCTCTATTCTGGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATTTATCTT TCGATCAAATATCTTTATTCATTTGAGCAGTTGGTATCACTGCATTATTACTATTACTTTCTTTACCTGTTTTAGCAGGAGCTATTACAATATTATT AACAGATCGAAACTTAAACACTTCATTCTTTGATCCTGCAGGAGGAGGTGATCCTATTTTATATCAACATTTATTT

Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution , Washington, DC, USA ( USNM), illustrated in Fig. 29–30, bears the following four rectangular labels, three white: [ ECUADOR: Esmeraldas: | Río Chuchuví, km. 12.5 Lita- | San Lorenzo rd. 800-900m | 0° 53.01’ N 78° 30.90′ W | I.2001 I.Aldas leg.], [DNA sample ID: | NVG-18017A03 | c/o Nick V. Grishin], [USNMENT | {QR Code} | 01450831], and one red [HOLOTYPE ♂ | Aguna esmeralda | Grishin] . Paratypes: 4♂♂ from Ecuador: Esmeraldas Province: 2♂♂ from the type locality: NVG-18017A04 USNMENT_01450832 the same data as the holotype, but collected in Mar-2001 [ USNM] ; and NVG-18066C 08 Oct-2012, ex coll. M. Büche [EBrockmann]; 1♂ NVG-18016H04, USNMENT_01450823 Km 18.5 San Mateo-Pto. Libre Road, Zapatta Hilltop, 500 m, GPS 0.884500, −79.540333, 6-Mar-2001, D. H. Ahrenholz leg. [ USNM] ; 1♂ NVG-18065E11 Durango, 500-800 m, Mar-Jun-2011, ex coll. M. Büche [EBrockmann].

Type locality. Ecuador: Esmeraldas Province, Río Chuchuví, km. 12.5 Lita-San Lorenzo Road, elevation 800– 900 m, GPS 0.883500, −78.515000.

Etymology. The name is formed from the Esmeraldas Province, the type locality of this species. The name is a noun in apposition, originating from a Greek word meaning emerald, which also nicely reflects the emeraldgreen color on the dorsal hindwing of this species.

Distribution. Currently known from northwestern Ecuador.