Pseudodrephalys tinas Grishin, 2023

Zhang, Jing, Cong, Qian & Grishin, Nick V., 2023, Supplementary Materials and Appendix, Insecta Mundi 2023 (26), pp. 1-115 : 24-25

Pseudodrephalys tinas Grishin , new species

https://zoobank.org/ 37160735-2E27-4AE4-9B65-DBD0DD58B076

( Fig. 2 part, 49–52, 262–263)

Definition and diagnosis. Genomic sequencing reveals that two specimens from Iquitos, Peru, identified as Pseudodrephalys atinas (Mabille, 1888) (type locality in Peru) are sister to Pseudodrephalys sohni Burns, 1999 (type locality in Brazil: Amazonas) with P. atinas being a more distant species ( Fig. 2): COI barcodes differ by 4.7% (31 bp) from P. atinas syntype and 1.8% (12 bp) from P. sohni holotype. Due to genetic differentiation, the two Peruvian specimens represent a new species, which is distinguished from its relatives by a narrower valva with a larger cleft between the harpe and ampulla than in P. sohni and a much narrower harpe with a smaller cleft separating it from ampulla compared with P. atinas . In facies, males differ from P. sohni by the ventral hindwing white band being narrower and interrupted in the middle of the cell CuA 2 -1A+2A, thus leaving an isolated spot near the anal fold; from P. atinas by this band reaching Sc+R 1 (instead of ending at Rs); and from both P. sohni and P. atinas by the postdiscal pale lavender line on ventral hindwing being vestigial. Females differ from P.atinas by a strongly concave border of the basal yellow-orange basal area of ventral hindwing and from P. sohni by not being similar to males in wing pattern (e.g., having a round ventral hindwing white spot instead of a band). Due to the somewhat cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly671.6.3:T102C, aly6954.5.63:C66T, aly207.8.7:A150G, aly4456.10.1:A194G, aly 1709.2.6:C87G, and COI barcode: A28G, A100T, T361C, T535C, 616C.

Barcode sequence of the holotype. Sample NVG-19039F10, GenBank OR837644, 658 base pairs: AACTTTATACTTTATTTTTGGAATTTGGGCAGGAATAGTAGGTACTTCTTTAAGATTATTAATTCGTACTGAATTAGGAAATCCAGGATCTTTAATT GGTGATGATCAAATTTATAATACTATTGTTACAGCTCACGCTTTTATTATAATTTTTTTTATAGTTATGCCAATTATAATTGGAGGATTTGGAAATT GATTAGTACCTCTGATACTAGGAGCTCCTGATATAGCATTCCCACGAATAAATAATATAAGATTTTGACTACTTCCCCCCTCTTTATTGTTATTAAT TTCAAGAAGTATTGTAGAAAATGGTGCTGGAACTGGATGAACTGTATATCCTCCTCTTTCTTCTAATATCGCCCATCAAGGAGCATCAGTAGATTTA GCAATTTTTTCATTACATTTAGCAGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATCTTTCCT

TTGATCAATTACCCTTATTCGTATGAGCTGTTGGTATCACAGCTTTACTCTTATTACTCTCTTTACCAGTATTAGCTGGAGCTATTACTATACTATT AACTGATCGAAATTTAAATACATCTTTTTTTGACCCTGCGGGAGGAGGAGATCCAATCTTATATCAACATTTATTT

Type material. Holotype: ♂ currently deposited in the American Museum of Natural History , New York, NY, USA ( AMNH), illustrated in Fig. 49–50, bears the following six rectangular labels, five white: [Iquitos, Peru | XII-15 1930], [G646], [DNA sample ID: | NVG-19039F10 | c/o Nick V. Grishin], [Leg removed on | 20-Feb-2019 by | N. V Grishin for | DNA extraction], [{QR Code} | AMNH _ IZC 00337700 ] and one red [HOLOTYPE ♂ | Pseudodrephalys | tinas Grishin ] . Paratype: 1♀: NVG-19039F11, AMNH _IZC 00337701, the same data as the holotype ( Fig. 51–52).

Type locality. Peru: Loreto Region, Iquitos.

Etymology. The name is formed by removing the negating prefix “a” from atinas . In Latin, tinus means small or tiny. This species has a smaller ampulla. The name is a noun in apposition.

Distribution. Currently known only from Northern Peru.