Dion occida Grishin, 2023

Zhang, Jing, Cong, Qian & Grishin, Nick V., 2023, Supplementary Materials and Appendix, Insecta Mundi 2023 (26), pp. 1-115 : 71-72

Dion occida Grishin , new species

https://zoobank.org/ 0458BF11-8AEB-4AF2-8B02-A4F6DF108B58

( Fig. 7 part, 173–174, 404–406)

Definition and diagnosis. Phylogenetic trees reveal that several specimens identified as Dion agassus (Mabille, 1891) (type locality type locality Brazil: Amazonas, Massauary, lectotype sequenced as NVG-15036E10) show prominent genetic differentiation from it in the Z chromosome and are sister to Dion bora new species ( Fig. 7), but their COI barcodes differ from D. bora by 4.1% (27 bp) while being closer to sympatric D. agassus , probably due to introgression: 1.1% (7 bp). Therefore, these specimens represent a new species that keys to “ Enosis pruinosa agassus ” (K.4.3(a)) in Evans (1955) and differs from its relatives by a combination of the following characters: ventral hindwing with comparatively reduced blue metallic overscaling and on forewing replaced by purple tint overscaling, similar to D. agassus , but hindwing discal cyan-blue spots are most prominent on the blue ground color, and blue overscaling is framing the inner margin ( Fig. 174), the tube-like arched upcurved process from near the base of harpe is thicker and shorter, harpe is narrower, rounder, with a straight or convex dorsal margin that bears a small hump directed partly inward and anteriad, costa more concave ( Fig. 405–406). Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly87.2.2:C44T, aly1259.30.6:C96T, aly 2130.12.1:C174T, aly349.2.5:A264G, aly 2130.9.3:C120T, and COI barcode: T59C, T322G, T373C, T533C, T616T.

Barcode sequence of the holotype. Sample NVG-19023G05, GenBank OR837701, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTACTAATTCGAACAGAATTAGGTAATCCTGGCTCTTTAATT GGAGACGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGTAATT GATTAGTCCCTCTAATACTAGGAGCACCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGAATACTACCACCCTCACTTATACTATTAAC TTTTAGTAGAATTGTAGAAAATGGAGCAGGGACTGGATGAACAGTTTACCCCCCTCTTTCTTCTAATATTGCTCATCAAGGCTCTTCAGTTGATTTA GCAATTTTTTCATTACATTTAGCAGGAATTTCTTCTATTTTAGGCGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAACTTATCAT TTGATCAAATACCTTTATTTGTGTGATCTGTAGGTATTACAGCCTTACTGTTACTACTATCTTTACCAGTATTAGCAGGAGCTATTACAATACTTCT CACTGATCGAAATTTAAATACTTCTTTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Type material. Holotype: ♂ currently deposited in the National Museum of Natural History , Smithsonian Institution, Washington, DC, USA ( USNM), illustrated in Fig. 173–174, bears the following six rectangular labels, five white: [ PERU 300m | 30 Km S. W. | Pro. Maldonado | 27 Oct. ’83 | S. S. Nicolay], [♂ genitalia | slide/vial # | H790 | Prep. S.S. Nicolay], [ Enosis ♂ | pruinosa | Det. pruinosa | S.S. Nicolay], [DNA sample ID: | NVG-19023G05 | c/o Nick V. Grishin], [USNMENT | {QR Code} | 01532869], and one red [HOLOTYPE ♂ | Dion occida | Grishin] . Paratypes: 2♂♂ [ USNM]: NVG-19023G04, USNMENT_01532868 Venezuela: Amazonas, Cerro de la Neblina basecamp, 140 m, GPS 0.8333, −66.1667, 10–20-Feb-1985, P. J. and P. M. Spangler, R. A. Faitoute, W. E. Steiner leg. and NVG-19023G06 with a single label “17o46-55. S. Lat. 63-5-34 Long.”, which we interpreted as Bolivia: Santa Cruz department, Santa Cruz de la Sierra, GPS −17.7819, −63.0928.

Type locality. Peru: Madre de Dios Region, 30 km SW of Puerto Maldonado, elevation 300 m.

Etymology. In Latin, occidentalis means western. The name signifies the westernmost species of the D. uza group and is a noun in apposition.

Distribution. Currently known from Venezuela, Peru, and Bolivia.