Talides eluta Grishin, 2023
publication ID |
https://doi.org/10.5281/zenodo.10396362 |
DOI |
https://doi.org/10.5281/zenodo.10622138 |
persistent identifier |
https://treatment.plazi.org/id/03810139-FF8B-BB04-C0CA-FC65E78BB5E4 |
treatment provided by |
Felipe |
scientific name |
Talides eluta Grishin |
status |
sp. nov. |
Talides eluta Grishin , new species
https://zoobank.org/ 900BB006-C1DB-4CC9-ADD3-B2393A6B4539
( Fig. 8 part, 203–204, 442–443)
Definition and diagnosis. Phylogenetic trees reveal that several specimens of Talides Hübner, [1819] (type species Talides sinois Hübner, [1819] ) from Peru and Brazil show prominent genetic differentiation from named species of this genus ( Fig. 8): e.g., their COI barcodes differ from that of Talides alternata E. Bell, 1941 (type locality in Brazil: Santa Catarina , holotype sequenced as NVG-18025D05) by 5.6% (37 bp), and therefore represent a new species. This new species keys to T. alternata hispa (K.13.3(b)) in Evans (1955) but differs from it by less rounded wings and less contrasting patterns of ventral side, shorter and not as bright orange fringes, straighter and shorter upper segment of stigma, and a more elongated and thinner apical spot in the cell R 5 -M 1. Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly 1244.8.2:G99A, aly927.2.7:G49T, aly927.2.7:G128A, aly596.8.4:C10A, aly35002.7.1:C96T, and COI barcode: T247C, T373C, T436A, T482A, A622G.
Barcode sequence of the holotype. Sample NVG-18012D01, GenBank OR837716, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACTTCTTTAAGATTATTAATTCGAACAGAATTAGGTAATCCAGGATTTTTAATT GGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATT GATTAGTTCCTCTTATACTTGGAGCCCCTGATATAGCTTTCCCCCGAATAAACAATATAAGATTCTGAATACTTCCCCCTTCTTTAACATTATTAAT TTCAAGAAGAATTGTAGAAAATGGTGCTGGTACAGGATGAACTGTATATCCCCCTCTTTCAGCTAATATTGCTCATCAAGGCTCATCTGTTGATTTA GCAATTTTTTCCCTTCATTTAGCAGGAATTTCTTCTATTTTAGGAGCAATTAACTTTATTACAACAATTATTAATATACGAATTAGAAATTTAATAT TTGATCAAATACCTCTATTTGTATGATCTGTGGGAATTACAGCTTTATTATTATTATTATCTTTACCTGTTTTAGCAGGAGCTATTACTATACTTCT TACTGATCGTAATTTAAATACTTCATTTTTTGACCCTGCGGGTGGAGGAGATCCTATTTTATACCAACATTTATTT
Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution , Washington, DC, USA ( USNM), illustrated in Fig. 203–204, bears the following four rectangular labels, three white: [ PERU: Cuzco 540 m. | Villa Carmen | Pilcopata 4057| 03-V-2015 Kinyon], [DNA sample ID: | NVG-18012D01 | c/o Nick V. Grishin], [USNMENT | {QR Code} | 01450290], and one red [HOLOTYPE ♂ | Talides | eluta Grishin ] . Paratypes: 3♂♂: 1♂ NVG-21046B04 Brazil: Rondônia, 5 km S Cacaulandia, linha C-10 (at Rio Pardo ) off B-65, 18-Apr-1995, O. Gomes leg., genitalia GTA-7238 [ MGCL] ; 2♂♂: Peru: Madre de Dios, Alto Madre de Dios at Pantiacolla Lodge , 400 m, GPS −12.6500, −71.2167 W. Dempwolf leg. [WRDempwolf]: NVG-18125D05, WRD 14975 4-Nov-2017 GoogleMaps ; and NVG-18125D07, WRD 14981 7-Nov-2017.
Type locality. Peru: Cuzco, Pilcopata, Villa Carmen Biological Reserve, elevation 540 m.
Etymology. In Latin, elutus means washed out. The name is given to signify the reduced coloration and duller appearance of this species compared to the new species described next. The name is an adjective.
Distribution. Currently known from Peru (Cuzco and Madre de Dios) and Brazil (Rondônia).
USNM |
Smithsonian Institution, National Museum of Natural History |
V |
Royal British Columbia Museum - Herbarium |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
Genus |