taxonID	type	description	language	source
2C0CEA1AFF8EFFC842111948DFDB6496.taxon	description	urn: lsid: zoobank. org: act: D 0 DE 3338 - 5 FF 3 - 4 F 7 E- 87 EA- 32 AFA 42281 B 2	en	Kästle, Benedikt, Binder, Stephanie, Jones, Nathan T., Coulis, Mathieu (2025): Description of a new genus and species of terrestrial isopod (Oniscidea, Armadillidae) endemic to Martinique. Zoosystema 47 (29): 721-729, URL: https://sciencepress.mnhn.fr/sites/default/files/articles/pdf/zoosystema2025v47a29.pdf
2C0CEA1AFF8EFFC842111948DFDB6496.taxon	type_taxon	TYPE SPECIES. — Caribodillo martinicensis n. sp.	en	Kästle, Benedikt, Binder, Stephanie, Jones, Nathan T., Coulis, Mathieu (2025): Description of a new genus and species of terrestrial isopod (Oniscidea, Armadillidae) endemic to Martinique. Zoosystema 47 (29): 721-729, URL: https://sciencepress.mnhn.fr/sites/default/files/articles/pdf/zoosystema2025v47a29.pdf
2C0CEA1AFF8EFFC842111948DFDB6496.taxon	diagnosis	DIAGNOSIS. — Animals capable of endoantennal conglobation. Body convex with flattened pereonites and pleonites epimera. Dorsal surface smooth and covered with small scale setae. Cephalon with frontal shield protruding over vertex. Pereonites 1 and 2 with ventral lobe. Ventral lobe on pereonite 1 broadly triangular. Ventral lobe on pereonite 2 slender, with anterior and posterior articulatory notch. Pereonites 3 - 7 epimera anteriorly thickened. Pereonites 1 - 7 with one line of small noduli laterales per side. Telson hourglass shaped. Mandibles with molar penicil dichotomized. Outer endite of maxillula with simple teeth. Uropod protopodite with rectangular distal portion, medial margin of protopodite weakly concave; uropod exopodite small and inserted near medial margin; uropod endopodite small. Pleopod exopods with monospiracular covered lungs.	en	Kästle, Benedikt, Binder, Stephanie, Jones, Nathan T., Coulis, Mathieu (2025): Description of a new genus and species of terrestrial isopod (Oniscidea, Armadillidae) endemic to Martinique. Zoosystema 47 (29): 721-729, URL: https://sciencepress.mnhn.fr/sites/default/files/articles/pdf/zoosystema2025v47a29.pdf
2C0CEA1AFF8EFFC842111948DFDB6496.taxon	etymology	ETYMOLOGY. — The new genus name Caribodillo n. gen. refers to the Caribbean, where Martinique is located, combined with - dillo, a suffix commonly used for members of the family Armadillidae.	en	Kästle, Benedikt, Binder, Stephanie, Jones, Nathan T., Coulis, Mathieu (2025): Description of a new genus and species of terrestrial isopod (Oniscidea, Armadillidae) endemic to Martinique. Zoosystema 47 (29): 721-729, URL: https://sciencepress.mnhn.fr/sites/default/files/articles/pdf/zoosystema2025v47a29.pdf
2C0CEA1AFF8EFFCC45D81BADD9C9614B.taxon	description	(Figs 1 A-C- 4) urn: lsid: zoobank. org: act: 4 E 9 AD 3 E 4 - 6 C 3 E- 4 B 56 - 8 F 9 F-AA 4 CBD 0 A 2 ED 2	en	Kästle, Benedikt, Binder, Stephanie, Jones, Nathan T., Coulis, Mathieu (2025): Description of a new genus and species of terrestrial isopod (Oniscidea, Armadillidae) endemic to Martinique. Zoosystema 47 (29): 721-729, URL: https://sciencepress.mnhn.fr/sites/default/files/articles/pdf/zoosystema2025v47a29.pdf
2C0CEA1AFF8EFFCC45D81BADD9C9614B.taxon	materials_examined	MATERIAL EXAMINED. — Holotype. Martinique • 1 ♂; Sainte Anne, Summit of Morne Manioc; 14 ° 26 ’ 0 ” N, 60 ° 51 ’ 26 ” W; 30. VIII. 2016; Mathieu Coulis leg.; under rock, dry forest; MNHN-IU- 2024 - 1859 Paratypes. Martinique • 3 ♂, 8 ♀; same data as holotype; MNHN- IU- 2024 - 1860 • 1 ♂, 2 ♀; same data as holotype; 25. VIII. 2024; Mathieu Coulis leg.; ZMB- 33422; • 1 ♂, 4 ♀; same data as holotype; 30. V. 2024; Regis Delannoye leg.; CBGP-FAUN- 17361 • 5 ♂, 6 ♀; pet trade; 30. V. 2024; Benedikt Kästle leg.; CBGP-FAUN- 17360; • 4 ♂, 6 ♀; pet trade; 30. V. 2024; Benedikt Kästle leg.; Genbank: PQ 489720; ZMB- 33421	en	Kästle, Benedikt, Binder, Stephanie, Jones, Nathan T., Coulis, Mathieu (2025): Description of a new genus and species of terrestrial isopod (Oniscidea, Armadillidae) endemic to Martinique. Zoosystema 47 (29): 721-729, URL: https://sciencepress.mnhn.fr/sites/default/files/articles/pdf/zoosystema2025v47a29.pdf
2C0CEA1AFF8EFFCC45D81BADD9C9614B.taxon	etymology	ETYMOLOGY. — The specific name refers to Martinique (latin.: Martinica), where the species was discovered.	en	Kästle, Benedikt, Binder, Stephanie, Jones, Nathan T., Coulis, Mathieu (2025): Description of a new genus and species of terrestrial isopod (Oniscidea, Armadillidae) endemic to Martinique. Zoosystema 47 (29): 721-729, URL: https://sciencepress.mnhn.fr/sites/default/files/articles/pdf/zoosystema2025v47a29.pdf
2C0CEA1AFF8EFFCC45D81BADD9C9614B.taxon	description	DESCRIPTION Male maximum body length 12 mm. Female maximum body length 15 mm. Color uniform orange to brown, frequently with gray cephalon and antennae (Fig. 1 B, C). Frontal shield with anterior margin weakly convex in dorsal view (Fig. 2 F). Eyes consisting of 17 ommatidia with raised lobe above each eye, continuing anteromedially as shallow elevated ridge (Fig. 2 E). Antennae short and slender. Antennula with seven subapical aesthetascs (Fig. 2 D). Pereonites 1 - 7 with posterior margin concave near epimera. Pereonite 1 epimera with rounded posterolateral corner, anterior corner acute. Pereonites 2 - 7 epimera rectangular (Fig. 2 A). Pereonite 1 ventrally with short lobe, broadly triangular and directed backwards. Pereonite 2 ventrally with narrow, spiniformlike tooth, directed outwards (Fig. 2 B, C). Telson longer than wide, distal portion elongate, posterior margin almost straight. (Fig. 2 H). Right mandible with 1 + 1 penicils; left mandible with 2 + 1 penicils (Fig. 3 F, G). Maxillula outer endite with 4 + 5 teeth; inner endite with two penicils, outer penicil twice as wide as inner penicil (Fig. 3 J). Maxilla with outer lobe twice as wide as inner lobe; inner lobe of maxilla covered with thick setae (Fig. 3 I). Maxilliped basis with outer margin convexly rounded; endite with two hook-like terminal setae, medial seta strong (Fig. 3 H). Pereopods 1 - 7 basis and ischium bearing few setae; carpus and propodus densely covered with setae on sternal margins; carpus with longitudinal antennal grooming brush (Fig. 2 I, J); dactylus with inner claw almost as long as outer claw. Uropod filling gap between pleonite 5 and telson (Fig. 2 H, K); protopodite elongate, 1.6 times longer than wide, with distal portion rectangular, posterior margin slightly rounded (Fig. 2 K); exopodite inserted dorsally close to the medial margin; endopodite less than one third the length of protopodite, almost twice as long as exopodite. Male Pereopods without sexual dimorphism. Pleopod 1 exopod triangular, slightly longer than wide, outer margin concave with deep incision at spiraculum; endopod 2.5 times longer than exopod, distal half bent outwards (Fig. 3 A). Pleopod 2 exopod triangular, longer than wide, outer margin strongly concave bearing deep incision at spiraculum; endopod slender, slightly longer than exopod (Fig. 3 B). Pleopod 3 and 4 exopods triangular, outer margin concave with shallow incision at spiraculum (Fig. 3 C, D). Pleopod 5 exopod rhomboid, outer margin almost straight (Fig. 3 E). DNA BARCODE The obtained mitochondrial cytochrome oxidase I (CO 1) sequence is available online at GenBank (https: // www. ncbi. nlm. nih. gov / genbank /) under the accession number PQ 489720. tactttgtat tttatttttg gggtatgggc tggtgtagta ggggcttctt tgagggtagttgttcgtatt gagttagggc aagcagggag gtttattgga gacgaccaga tctttaatgtgatggttact gcacatgctt ttgttataat tttttttata gtgataccta ttataattggagggtttggg aattgattaa cccccttaat actaggggcc cctgacatag ctttcccacgtataaacaac ctgaggttct gacttctacc tccttcttta acattattac tgac - tagggctctagttgag agaggggtag gaacagggtg aactgtttac cctcctttgg ctgggaacattgctcacaga ggaggggctg tggacttagg gattttttct ttacatctag ctggagcctcttctatccta ggggctgtaa attttattac cactatttta aatatacggg cagtaggaataaaattagat cggatccctt tgtttgtatg atctatcttt attactgcag ttcttt - tactcttatctttg cctgttctag ccggggctat tacaatactt ttaacagacc gtaattttaatacttctttt tttgacccta gaggaggtgg ggaccctatc ctgtatcagc atttgttttgattttttg We attempted to blast the obtained sequence against the BOLD and GenBank databases, but species-level identification was not possible in either database. By extending the similarity criteria, the closest matches found were, in BOLD, Spherillo dorsalis (Iwamoto, 1943) (81.6 %) and Buddelundia cinerascens (Budde-Lund, 1912) (81.3 %); and, in GenBank, an unidentified species of the genus Buddelundia Michaelsen, 1912 (81.3 %), Eluma caelata (Miers, 1878) (80 %), and Venezillo hasegawai (Nunomura, 1991) (79.9 %). This lack of matches with closely related taxa primarily reflects the very limited number of sequences available for Oniscidea, and particularly for Armadillidae, in the Neotropical region. UV FLUORESCENCE Strong fluorescence under 365 nm UV light was observed in the pleon (Fig. 4 A). Different individuals showed variation in the extent of fluorescence. Variation ranged from the entirety of the pleonites fluorescing bright blue to a medial fluorescing spot restricted to pleonites 1 and 2. The extent of observed fluorescence was notably greater in males, while females exhibited only limited fluorescence. Furthermore, all setae displayed high contrast under 365 nm UV light, with the largest setae exhibiting the strongest fluorescence, particularly the setae on the pereopods and mouthparts, as well as the medial scale field of the water-conducting system (Fig. 4 B, C).	en	Kästle, Benedikt, Binder, Stephanie, Jones, Nathan T., Coulis, Mathieu (2025): Description of a new genus and species of terrestrial isopod (Oniscidea, Armadillidae) endemic to Martinique. Zoosystema 47 (29): 721-729, URL: https://sciencepress.mnhn.fr/sites/default/files/articles/pdf/zoosystema2025v47a29.pdf
