Drastria pseudopicta Matov et Korb, sp. n.

(Map 18) (Figs. 139–141 (imago), 246, 247 (male genitalia), 285 (female genitalia))

Type malerial. Holotype: male, 5– 6.05.2015, Russia, Astrakhan Prov., Dosang, sands, leg. A. Belik (ZISP) . Paratypes: 523 specimens (ZISP, SKK, CKO, OPB). The type series in details described in the chapter “Material examined”. Type locality: Russia, Astrakhan Prov., Dosang, sands .

Uvarov, 1910: 167 [Kuzha-Tugai valley 90 km N of Temir; Kum-Kuduk sands on the right shore of Emba; Kok-Dzhida in the confluence of the rivers Emba and Kuldenen-Temir]; Sukhareva, 1972: 62 [Ayakguzhumdy, Zhamansai, Aznek, 70 km S Tamdybulak, 10 km N Tamnybulak]; Poole, 1989: 327, 330; Hacker, Miatleuski, 2001: 814 [Botkul; Urda; Kandagash; Bisen; Dzhaylau]; Goater et al., 2003: 77, map [North-West Kazakhstan)]: 256 [Ryn-kum sandy steppe NW Kandagash loc.; Ryn-kum sandy steppe NW Urda vill. env]; Poltavsky et al., 2010: 96 [Botkul]; Gorbunov, 2011: 56 [deserts of West Kazakhstan]; pl. 8, fig. 8 [Alshynsai].

Remark. It is quite difficult to determine which species was in fact listed in the literature references in the pair D. picta—D. pseudopicta sp. n., so we put into current references list only the records we can recognize for this species by the material known, distribution or illustrations. All other records listed in the literature as ‘ D. picta’ we placed in D. picta review.

Description. Forewing length in holotype 17 mm, in paratypes 13–20 mm. Forewing upperside ground color dark brown, medial field light gray, discal spot brown with dark brown margin. Ante- and postmedial lines dark brown, submarginal line light brown, marginal field gray. Hindwing upperside white with wide black marginal belt containing two white spots on its marginal part, and wide black discal spot connected with wide black marginal belt. Wings underside white, forewing with black middle belt and black marginal belt containing three wide white spots; hindwing with black discal spot, connected to the black marginal belt with three wide white spots. Fringes on its underside brown in forewing and white with brown central part; on its underside it is white with brown spots in central part. Male genitalia asymmetrical. Uncus thin, smoothly curved. Scaphium thin. Valvae narrow-based, ovate in apical parts. right valva is longer than left. Ampulla broadly based, on the right valva with additional ovate flap near dorsal margin. Left saccular extension of valva is long and thin, extending beyond the tip of valva; right saccular extension is shorter and broader, its itp is bluntly falcate. Juxta is broad, has two pairs of arms - dorsal and ventral. Harpe is thin, slightly curved, left harpe longer than right. Aedeagus tubular, broad, with v-shaped oblique tip. Vesica angled into two lobes of different size, the smaller has 3 broad and short diverticula, the large has also 3 diverticula of various size and shape, there is long and thin diverticulum between two lobes of vesica. In female genitalia papillae anales long and pointed, apophyes slender, relate in length to each other as 2:1; antrum wide, ostium bursae funnel-shaped, with broad sclerotised plate in the medial part; ductus bursae straight, sclerotised; bursa is oval, with short and curved bulla.

Differential diagnosis. The new species differs from the closely related D. picta by the COI sequence (see Fig. 328), wing pattern and genitalia structures. Differences in the wing pattern are located in the hindwing underside: in D. pseudopicta the black discal spot on the hindwing underside large and always widely connected with the marginal belt without color difference instead in D. picta the discal spot is smaller and darker than the narrow connection with the marginal belt; usually in D. picta the discal spot is well separated. Medial field on the upper side of the forewing usually gray in D. pseudopicta while in D. picta it often has yellow brown color. Vesica of D. pseudopicta has long and thin diverticulum between its two main lobes wich is absent in D. picta . The sclerotised plate in the medial part of ostium bursae in D. pseudopicta is in 2 times longer than in D. picta .

COI sequence. GenBank accession number: MK117770, holotype.

GGAATTTGAGCAGGAATAGTGGGAACTTCATTAAGTCTACTTATTCGAGCTGAATTAGGAAATC- CAGGATCTCTAATTGGTGATGATCAAATTTATAATACTATTGTTACAGCACATGCTTTTATTATA- ATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGAGC TCCTGATATAGCCTTTCCTCGAATAAATAATATAAGTTTTTGATTACTCCCTCCTTCATTAACTTTAT- TAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGGTGAACAGTTTATCCTCCTCTTTCAT- CAAATATTGCTCATAGAGGAAGATCAGTTGATTTAGCTATTTTTTCATTACATTTAGCTGGAATTT CATCAATCTTAGGAGCTATTAATTTTATTACTACTATTATTAATATACGATTAAATAATTTAATATTT- GATCAAATACCTCTATTTGTTTGAGCTGTAGGAATTACTGCTTTCCTCTTATTACTTTCTTTACCTG- TATTAGCGGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACCTCATTTTTTGATCCTGCTG- GAGGGGGA

Habitat (Figs. 298–303, 306). Deserts and semideserts, steppes, dry meadows. Elevation: 200–2000 m. Very flexible ecologically, can be found in almost all arid or semiarid biotopes inside its area.

Distribution. South Russia, Kazakhstan and Middle Asia: Saisan, Saur and Tarbagatai, Dzhungar and Boro- Khoro, Sinjan-Uigur autonomous area of China, foothills of North and West Tian-Shan, Ferghana valley, Gissar, deserts of Turkmenistan, Uzbekistan and North Iran including Kopet-Dagh mountains.

Material examined (in total: 524 specimens). Holotype: Russia . 1 ♂, 5– 6.05.2015, Astrakhan Prov., Dosang, sands, leg. A. Belik (ZISP) . Paratypes: Armenia. 1 ♂, Armenia, [leg. Eversmann], ex coll. Eversmann (ZISP) ; 1 ♀, 12.05.1925, pr. Eriwan, Parakar, leg. A. Schelkovnikov (ZISP) ; 1 ♂, 20.05.1960, Erevan, leg. Vardik [yan] (ZISP); 1 ♂, 13.06.1967, Astamat, leg. E. Milanowski (ZISP) ; 1 ♂, 10.06.1968, Oktemberyan, [leg. E. Milyanovsky] (ZISP) ; 2 ♀, 1– 6.06.1993, Garni, leg. М. Kalashan, ex coll. A. Nekrasov (ZISP) ; 2 ♂, 27– 29.07.1994, Gegamsky range, Vedy district, Gorovan desert, h= 600 m, leg. M. Kalaschan, slide N 2263а (Nekrasov), ex coll. A. Nekrasov (ZISP) ; 2 ♂, 10.06.1997, Gegamsky range, Vedy district, Gorovan desert, h= 600 m, leg. A. Dantchenko, ex coll. A. Nekra- sov (ZISP) . Azerbaijan. 1 ♀, 08.1914, Aresh distr., Geok-tapa, leg. Mordvilko (ZISP) ; 1 ♀, 17.06.1936, Nakhiche- van, [leg. M. Ryabov] (ZISP) . China. 1 ♂, 1 ♀, 6.04.1879, Khorgos, leg. Alph [eraky], ex coll. Grand Duke Nikolai Mikhailovich (ZISP) ; 5 ♂, 2 ♀, 04.1879, Kuldja, leg. Alph [eraky], ex coll. Grand Duke Nikolai Mikhailovich (ZISP) ; 2 ♀, Kuldja, ex coll. N. Filipyev (ZISP) ; 1 ♂, 1 ♀, Kuldscha, leg. M. Bartel, ex coll. O. John (ZISP) ; 1 ♂,

1 ♀, Kuldja (ZMHU) . Kazakhstan. 6 ♂, 5 ♀, 25.05.1907, Turgaisk Prov., Bolshie Barsuki, Chelkar lake, leg. Vol- man (ZISP) ; 1 ♀, 2.07.1907, Semirechye Prov., Sary-Togoy valley on the river Chagyr, leg. A. Yakobson (ZISP) ; 1 ♂, 1908, Syr-Darja, Perovsk, leg. Nikolsky, ex coll. O. John (ZISP) ; 9 ♂, 21.04– 10.05.1908, Syr-Darja, St. Baiga- kum, leg. Malyschew, ex coll. O. John (ZISP) ; 2 ♂, 18.05.1908, Emba, deserts near Kuzha-Tugai, leg. D. Borodin (ZISP) ; 5 ♂, 2 ♀, 22.07.1908, Turgaisk Prov., Malye Barsuki desert near Kara-Chokat, leg. N. Androsov (ZISP) ; 1 ♂, 29.08.1908, Turgaisk Prov., Bolshie Barsuki sands, Chelkar vic., leg. N.Androsov (ZISP) ; 4 ♂, 2 ♀, 4– 26.04.1909, Syr-Darja, Dshulek, leg. Koshantschikoff, ex coll. O. John (ZISP) ; 2 ♂, 30.04.1909, Syr-Darya Prov., Perovsk, leg. Е. Miller (ZISP) ; 33 ♂, 7 ♀, 1– 31.05.1909, 7.07.1910, Syr-Darja, Aj-Darle, leg. Koshantshikoff, ex coll. O. John (ZISP) ; 35 ♂, 5 ♀, 18.05.1910, prov. Syr-Darja, deser. Mujun-Kum, lac. Kargaly-Kul, leg. A. Golbeck (ZISP) ; 1 ♂, 19.05.1910, Muyun-Kum desert, 5 km S of Kargaly-Kul, leg. A. Golbeck, ex coll. O. John (ZISP) ; 4 ♂, 1915, Semi- rechye Prov., Dzharkent, leg. Dyakonov, ex coll. Dyakonov (ZISP) ; 1 ♂, 14.08.1930, Karakum desert, Ak-Kuduk sands, leg. E. Luppova (ZISP) ; 2 ♀, 17.08.1930, Karakum desert, Takyr-Kuduk dwell, leg. E. Luppova (ZISP) ; 1 ♂, 20.08.1930, Karakum desert, Kara-Dzhusgun sands, leg. E. Luppova (ZISP) ; 2 ♂, 2 ♀, 9.06– 19.07.1931, N Malye Barsuki, Koilibay, leg. E. Luppova (ZISP); 1 ♂, 7.05.1932, Aralsk, leg. unknown (ZISP) ; 1 ♂, Aktobe Prov., Bol- shie Barsuki sands, 10 km E Begembet, 46º58’07,8” N 59º13’35,4” E, leg. T. Trofimova and D. Shovkoon (ZISP) ; 1 ♀, 9.05.1936, Alma-Ata Prov., Ili river, Iliysk, leg. Slivinsky (ZMMU) ; 3 ♂, 1 ♀, 9.09.1951, 16.05– 18.06.1952, Urda, leg. Levin (ZISP); 4 ♂, 11– 14.05.1967, Sary-Tau-Kum desert, upper course of Ili river near Aidarly, leg. Seitova (ZISP) ; 1 ♂, 8.05.1975, Guryev Prov., Aibis valley, leg. Shevin, ex coll. A. Nekrasov (ZISP) ; 1 ♂, 4 ♀, 1– 16.05. 1981, 150 km NNE Alma-Ata, Sarytaukum, leg. Reznik (ZISP) ; 1 ♂, 8.05.1985, SE Kazakhstan, Bozoi, leg. V. Linsky (ZISP) ; 4 ♂, 1 ♀, 17.05– 15.09.1987, 11.04. 1988, 150 km NE Alma-Ata, Ili river right shore, Mynbulak valley, leg. M. Falkovich (ZISP) ; 1 ♂, 24.05.1987, Moyunkum, leg. Amirguzhin (ZISP) ; 1 ♀, 2.05.1990, Zhel- Turanga, leg. S. Toropov, ex coll. A. Nekrasov (ZISP) ; 1 ♂, 1 ♀, 16.05.1994, 78º27´E, 43º46´N, Prov. Almaty, 22 km N Masak, 600 m, leg. Gy. Fabian and I. Retezar (HNHM) ; 1 ♂, 3 ♀, 22.06.1999, Boro-Khoro Mts., 45 km N of Panfilov (SKK) ; 1 ♂, 29.04.2005, desert Bolshie Barsuki, sands, leg. O. Novikov (OPB) ; 1 ♂, 1– 2.05.2005, desert Malye Barsuki, vill Shagar, leg. O. Novikov (OPB) ; 1 ♂, 21.06.2010, Karaganda Province, Moiyunkum Sands at Sary-Su River, 46º12’ N 67º06’ E, leg. P. Gorbunov (ZISP) ; 3 ♂, 23.04.2011, Kapchagaj GES environs, h= 544 m, 43º55’51.7” N 77º05’30,8” E, leg. S. Korb (ZISP, SKK) ; 12 ♂, 4 ♀, 23– 24.04.2011, Almaty Prov., 5 km N of Kap- chagai, leg. S.A. Knyazev (CKO); 4 ♂, 8 ♀, 25– 27.04.2011, 32 km NW of Bakanas, Ili river, leg. S.A. Knyazev (CKO) ; 1 ♂, 1 ♀, 26.04.2011, Almaty Prov., 40 km N of Bakanas, N 41 53.940, E 75 53.479, 377 m, leg. S.K. Korb (SKK) ; 2 ♂, 28– 30.04.2011, Alma-Ata Prov., Altyn-Emel Nature Reserve, Singing Dunes near Ili river, 677 m, leg. S.K. Korb and P.Egorov (SKK) ; 5 ♂, 17.05.2011, Kazaly distr., Basykara env., near r. Syr Daria, h= 67 m, 45.755º N 62.303º E, leg. A. Rokhletzova (ZISP) ; 1 ♀, 26.04.2012, Kumzhargan sands at Zhagabulak vill., 47 km SW of Emba town, 48º33’N, 57º37’E, leg. P. Gorbunov (OPB) ; 2 ♂, 6– 7.05.2013, 17 km SSE of Topar, desert, leg. S.A. Knyazev (CKO) ; 1 ♂, 11– 12.08.2013, Bukhtarma, 16 km SE of Bastaushi, sands, leg. S.A. Knyazev (CKO) ; 1 ♀, 10.07.2016, Ili river valley, Akzhar village, 44º52’ N 75º53’ E, leg. P. Gorbunov (ZISP) ; 2 ♂, 15– 16.09.2016, 5 km N of Kanshengel, desert, leg. S.A. Knyazev (CKO) ; 5 ♂, 5– 6.05.2017, Kyzylorda Prov., 13 km N of Aiteke Bi, sands, leg. S.A. Knyazev (CKO) ; 1 ♂, 5– 6.05.2017, 15 km NE of Kyzylorda, sands, leg. S.A. Knyazev (CKO) ; 6 ♂, 2 ♀, 6.05.2018, Mangystau Prov., 55 km NNE Zhanaozen, Sauskan sands, 43º48’07”N, 53º13’18”E, leg. A. Samus (SKK) ; 12 ♂, 3 ♀, 12– 14.06.2018, Aidarly env., 43.993779 N, 79.483105 E, leg. A. Litovtsev (SKK) . Kyrgyzstan. 1 ♂, Naryn, leg. unknown, ex coll. O. John (ZISP) ; 2 ♂, 8.08.2014, Bishkek environs, Kok-Jar, 900 m, leg. S.K. Korb (SKK) ; 1 ♂, 20.04.2016, Bishkek environs, Kok-Jar, 900 m, leg. S.K. Korb (SKK) . Mongolia. 1 ♂, 1 ♀, 16– 28.07.1981, Bayan-Khongorsky aimak, 140 km S Shine-Dzhinsta, Ekhiyn-Gol, leg. A. Lvovsky (ZISP) . Russia. 1 ♂, 6– 7.05.2015, Astrakhan Prov., Dosang, sands, leg. A. Belik (ZISP) ; 1 ♂, 1 ♀, Astrakhan region: Narün, leg. M. Bartel, ex coll. O. John (ZISP) ; 12 ♂, 4 ♀, 5.05.1924, 6.05.1926, 21.05.1939, Republic of Daghestan, Kumtorkale, [leg. Ryabov], slide N 6200 [Ryabov] (ZISP) ; 9 ♂, 6 ♀, 22– 25.06.1970, Dosang, leg. A. Lvovsky (ZISP) ; 1 ♀, 6– 10.05.1998, Stepnoe vic., sandy steppe, leg. V. Anikin (ZISP) ; 1 ♂, 30.06.2003, 18 km W Makhachkala, Barkhan Sarykum Nature Reserve, leg. D. Magomedova (ZISP) ; 3 ♀, 24– 25.05.2008, Bogdinsko-Baskynchaksky Nature Reserve, Green Garden, 48º03’N 46º53’ E, leg. S. Nedoshivina (ZISP) ; 1 ♂, 12– 17.05.2014, Saratov region, Khval- ynsk distr., 5 km W Khvalynsk, Dacha Khrenova, summer camp of the Saratov University, 52º29’26” N 48º02’75” E, leg. V. Anikin (ZISP) . Tadjikistan. 1 ♂, 10.04.1948, 6 km N Bura-Tau, Sandy Pass, leg. Y. Stshetkin (ZISP); 1 ♂, 21.04.1949, Vakhsh river, Staraya Pristan, leg. Y. Stshetkin (ZISP) ; 9 ♂, 10 ♀, 11– 13.04.1966, Gissarsky Mts., Dzhar-Kurgan env., leg. Danilevsky (ZISP) . Turkmenistan. 3 ♀, Krasnovodsk, leg. unknown, ex coll. Erschov (ZISP) ; 1 ♂, Ashkhabad, Tekke, ex coll. N. Filipyev (ZISP) ; 1 ♀, 04, Askhabad, leg. unknown, ex coll. Grand Duke Nikolai Mikhailovich (ZISP) ; 1 ♂, Krasnovodsk, leg. O. Herz (ZISP) ; 1 ♀, Usun Ada, ex coll. Grand Duke Nikolai Mikhailovich (ZISP) ; 2 ♂, 04.[18]84, Askhabad, leg. Kom [arov], ex coll. Grand Duke Nikolai Mikhailovich (ZISP) ; 1 ♂, 1 ♀, 24.03– 20.04.1891, Aidara, leg. Eylandt, ex coll. Grand Duke Nikolai Mikhailovich, slide N 6468 (Ry- abov) (ZISP) ; 2 ♂, [18]96, Transcaspian Prov., Askhabad, leg. Anger (ZISP) ; 1 ♀, 5.04.1900, Transcaspian Prov., Uch-Adzhi station, leg. Germs (ZISP) ; 1 ♂, 6.04.1903, Repetek, leg. Anger (ZISP) ; 1 ♂, 04.05.1937, Repetek, leg. Lavrov (ZISP) ; 1 ♀, 10.05.1910, Kelif on Amu-Darya, leg. Zarudny (ZISP) ; 1 ♂, 19.04.1911, Buchara, stc. Farab, leg. A. Golbeck (ZISP) ; 12 ♂, 7 ♀, 16.03– 1.05.1912, Transcaspian Prov., Imam-Baba, leg. Kozhantshikov (ZISP) ; 19 ♂, 16 ♀, 12.04– 12.09.1913, Chardzhui on Amu-Darya river, leg. Samokish (ZISP) ; 13 ♂, 12 ♀, 31.07.1936, Repetek, leg. A.V. Zvetaev (ZMMU) ; 4 ♂, 4 ♀, 3– 4.04.1941, Repetek, [leg. A. Zvetaev] (ZISP) ; 3 ♂, 3 ♀, 23.04.1951, Uzboi, Topyatan lake, leg. Schteinberg (ZISP) ; 1 ♂, 1951, Uzboi, SW of Burgun, leg. Schteinberg (ZISP) ; 1 ♀, 2.05.1951, Messerianskoe plateau, leg. Schteinberg (ZISP) ; 1 ♀, 20.04.1952, 35 km NE of Kizil-Arvat, Toutly vic., leg. Schteinberg (ZISP) ; 1 ♂, 20.04.1952, Toutly NO Kizil-Arvat, leg. Schteinberg (ZISP) ; 2 ♂, 5 ♀, 30.04– 2.05.1953, 40 km N Kizil-Arvat, Kara-Bogaz, leg. V. Kuznetcov (ZISP); 4 ♂, 1 ♀, 18.05– 3.06.1953, 40 km N Kizil- Arvat, Kara-Bogaz, leg. Maslennikova (ZISP); 1 ♂, 6 ♀, 18.11.1954, 13– 22.05.1955, Aschabad circ., leg. W. Poto- polskij (ZISP); 2 ♂, 1 ♀, 18.04.1955, Repetek, leg. Fokanova (ZISP); 2 ♀, 18– 27.04.1965, Central Kara Kum, Bakharden sovkhoz, Kirpili kolkhoz, leg. М. Daricheva (ZISP) ; 1 ♂, 3 ♀, 14– 25.04.1966, Repetek, desert, leg. A. Zvetaev, ex coll. A. Nekrasov (ZISP) ; 1 ♂, 1 ♀, 12– 13.04.1967, Repetek, leg. unknown (ZISP); 4 ♂, 1 ♀, 19– 21.04.1979, Badkhyz Nature Reserve, leg. A. Lvovsky (ZISP) ; 6 ♂, 2 ♀, 28.03– 5.04.1980, 1– 21.05.1981, Repetek, leg. M. Falkovich (ZISP); 1 ♀, 11.05.1981, Kushka, leg. M. Nesterov (ZISP) ; 2 ♀, 22– 25.05.1981, Repetek, leg. V. Krivokhatsky (ZISP) ; 2 ♂, 1 ♀, 27.04.1982, Badkhyz, Kyzyldzhar, leg. M. Falkovich (ZISP) ; 1 ♀, 14.04.1987, Kopet-Dagh Mts., Geok-Tepe, Babarab vill., leg. V. Prasolov (ZISP) ; 1 ♂, 5 ♀, 24– 27.04.1988, Askhabad Prov., Geok-Tepe distr., Babarab vill., leg. M. Prokofyev (ZISP) . Uzbekistan. 1 ♀, Russky Turkestan, 30, [leg. Fedtch- enko], ex coll. Erschov (ZISP) ; 4 ♂, 18.04.[?], Kizil Kum., Igam-Berdy, leg. unknown, ex coll. Grand Duke Nikolai Mikhailovich (ZISP) ; 1 ♂, 3.05.1892, Samarkand, leg. O. Herz, ex coll. Grand Duke Nikolai Mikhailovich (ZISP) ; 1 ♀, 24.05.1912, Kyzyl-Kum, Akskur-kuduk, leg. Zarudny (ZISP) ; 3 ♂, 1 ♀, 13.04.1950, South Uzbekistan, Dzhar- Kurgan, leg. A.V. Zvetaev (ZMMU) ; 1 ♀, 20.04.1966, Kyzyl Kum desert, 65-70 km NW Dzhing [ildy], leg. Pastuk- hov (ZISP) ; 1 ♂, 29.04.1966, Kyzylkum, Aktau, leg. Pastukhov (ZISP) ; 1 ♂, 9.05.1966, Kyzylkum desert, Au- minzatau, leg. Pastukhov (ZISP) ; 2 ♂, 24.05.1972, 29.04. 1975, 140 km NW Shafrikan, Zhamansai, leg. M. Falkovich (ZISP) ; 1 ♀, 25.05.2010, Kyzylkum, no collector data (CKO) .