Amauropelma matakecil Miller & Rahmadi sp. n. Figs 113

Material examined.

Holotype: Indonesia, Central Java, Purworejo, Kaligesing, Tlogoguo Village, Somoroto: Gua Anjani [Anjani Cave], 7.73156°S, 110.11567°E, 672 m asl., 23 March 2009 (MZB.Aran.500, S. Harjanto), 1 #f.

Paratypes: Indonesia, Central Java, Purworejo, Kaligesing, Donorejo Village, Katerban: Gua Seplawan [Seplawan Cave], 7.7726°S, 110.111°E, 23 April 2010 (MZB. Aran .501, S. Harjanto and C. Rahmadi), 1 #f; Indonesia, Central Java, Purworejo, Kaligesing, Donorejo Village, Katerban: Gua Nguwik [Nguwik Cave], 7.76907°S, 110.10334°E, 764 m asl., 9 May 2008 (RMNH.ARA.12434, S. Harjanto), 1 #f.

Additional material examined: Indonesia, Central Java, Purworejo, Kaligesing, Tlogoguo Village, Somoroto: Gua Anjani [Anjani Cave], 7.73156°S, 110.11567°E, 672 m asl., 23 April 2010 (RMNH.ARA.12436, S. Harjanto and C. Rahmadi), 2 juveniles; Gua Anjani [Anjani Cave], 7.73156°S, 110.11567°E, 672 m asl., 23 March 2009 (MZB.Aran.502, S. Harjanto), 1 juvenile.

Etymology.

The specific name is an adjective derived from "mata" meaning eyes and "kecil" meaning small from Bahasa Indonesia referring to the small eyes of the species. Pronunciation note: the letter “c” in Bahasa is pronounced like “ch” in English.

Diagnosis

. Distinguished from other Amauropelma species by having more cheliceral teeth (4 promargin and 7 retromargin teeth, Fig. 4; other described species for which data were recorded range between 1-4 promargin and 4-6 retromargin teeth); by the relatively proximal position of the tarsal organs (Fig. 10); by the sclerotized epigynal teeth that do not conduct the copulatory ducts (Fig. 7; other Amauropelma have soft teeth containing the copulatory ducts); and by the shape of the epigynum, which has the lateral wings more long and narrow than other species (Fig. 7). Further distinguished from other Amauropelma species except Amauropelma leo Raven & Sumkat, 2001 by having small eyes (Fig. 2; large in other species except Amauropelma undara, which is a blind troglobite); distinguished from Amauropelma leo by the pale, troglomorphic color (Figs 1, 3); Amauropelma leo is a rainforest species and is not troglomorphic.

Description.

Female (holotype, MZB.Aran.500): Carapace 3.40 long, 2.20 wide. Abdomen 4.12, long 2.64 wide. Total length 7.7. Carapace with fine setae. Fovea a narrow groove. Chilum divided (Fig. 2). Endites slightly converging, labium longer than wide (Fig. 4). Color. Overall pale, chelicerae and ocular region darker (Figs 1, 3). Eyes. Vestigial, eye rows recurved forming 2.4.2 pattern, ALE>AME=PME>PLE, AME on small common tubercle, ALE and PME form slightly procurved row, PME closer together than PME-ALE, PME slightly more widely spaced than AME, eye group = 0.40 of carapace width (Figs 2, 3). Chelicerae. Large, partially porrect with lateral boss. Retromargin with 5 large distal and 2 small proximal teeth; promargin with 4 teeth, the third (counting proximally from the base of the fang) is the smallest (Fig. 4). Pedipalp. Tarsal claw with series of basal teeth. With two large ventral distal setae (ca. Silva Dávila 2003: fig. 28d). Legs. Formula 4123. Paired tarsal claws with series of basal teeth, claw tufts present, weak scopula present on tarsi and metatarsi I and II (Fig. 9). Retrocoxal hymen present on leg I. Trochanters deeply notched (Fig. 5). Tarsal organs slightly raised, dome-like, more distal on legs I and II than III and IV (I: 0.77. II: 0.73. III: 0.66. IV: 0.67). Macrosetae: I: fe p1d3; pa 0; ti v2.2.2.2.2; me v3.3.3; ta 0. II: fe d3r1; pa 0; ti v2.2.2.2.2; me v3.3.3; ta 0. III: fe p4d3r4; pa p1r1; ti v2.2.2p1.1d1.1 r1.1; me v2.2.2p1.1.2r1.1.2; ta 0. IV: fe p3d3r1; pa r1; ti v2.2.2p1.1d1.1r1.1; me v1.1.1.1.2p1.1.1d0.1.2r1.1.1. Spinnerets. Ecribellate, colulus absent, lateral spinnerets cylindrical with short apical segment, ALS separated by about their width, PLS and PMS with a number of large, conspicuous spigots (Figs 11, 12). Epigynum. Sclero tized plate with long, narrow lateral wings with concave posterior margins. Epigynal teeth sclerotized, arise posterior to lateral wings (Fig. 7). Copulatory openings on dorsal surface near lateral margins of wings, follow posterior margin of wings to reniform spermathecae (Fig. 8).

Natural History.

In Seplawan Cave, Amauropelma matakecil was found on the cave floor hiding under crevices in dry mud.

Distribution.

Amauropelma matakecil is known only from three caves in the Jonggrangan Limestone, part of the Menoreh Hills in the District of Kaligesing, Purworejo Regency, Central Java, near the border with Yogyakarta Province (Fig. 13). The Jonggrangan Limestone is located from 574-878 m above sea level (Bemellen 1949). This karst formation is a fossil reef with thicknesses up to 200 m at the southern margin of the Jonggrangan Plateu (Bemellen 1949). The formation dates from the Middle to Late Miocene (Sulistyaningrum and Rahardjo 2010). Karst makes up a very small area of the Menoreh hills, about 15 km2. The nearest neighboring limestone formations are the Gombong Selatan (about 72 km to the west) and the Gunung Sewu Karst (about 42 km to the east).

Remarks.

The cave spider fauna of Java is not well known. The only other spider documented from a cave in Java that we are aware of is Althephus javanensis Deeleman-Reinhold, 1995 ( Ochyroceratidae). This species is not strongly troglomorphic, exhibiting neither eye reduction nor reduced pigmentation, although legs in specimens from caves are considerably longer than in specimens from the surface. As reported by Rahmadi (2011), Amauropelma matakecil is the most remarkable cave spider so far known from Java due to its large size, reduced eyes, and potential conservation importance. Karst formations in Java are highly threatened by human activities such as limestone mining and habitat conversion.

DNA Barcode.

AACGTTATATTTAATATTTGGAGCTTGATCTGC TATAATAGGAACGGCTATAAGAATATTAATTCGAATAGAGTTAGGA CATTCTGGAAGATTATTAAGTAATGATCATTTGTATAATGTGATTGT TACTGCTCATGCATTTGTTATAATTTTTTTTATGGTGATGCCAATTT TAATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTC CGGATATATCGTTTCCTCGAATAAATAATTTGTCTTTTTGATTGTTAC CTCCTTCTTTGTTTTTGTTGTTTATATCTTCTATAGTTGAAATGG GAGTAGGAGCTGGATGAACTATTTATCCCCCTTTAGCTTCTAGAATTG GTCATGTGGGAAGATCTATGGATTTTGCTATTTTTTCTTTACATT TAGCTGGAGCTTCTTCTATTATAGGGGCGGTAAATTTTATTTCTAC GATTGTAAATATACGTTTATTAGGAATAAGAATAGAAAGGGTTCCTT TATTTGTGTGATCTGTATTTATTACTGCTGTTTTATTATTATTATCTT TACCTGTTTTAGCGGGAGCTATTACTATGTTATTGACGGATCGAAATTT TAATACTTCTTTTTTTGACCCTGCAGGGGGAGGGGATCCTATTT TATTTCAACATTTGTTT (MZB.Aran.501, GenBank accession number JQ277219).

Among identified spiders accessible at the time of writing (October 2011) through the NCBI database (http://blast.ncbi.nlm.nih.gov/Blast.cgi), Amauropelma matakecil blasts most closely with the pisaurid genus Dolomedes Latreille, 1804. This despite the presence in GenBank of the homologous locus for several ctenid spiders (e.g., Crews and Gillespie 2010). However, its closest matches are several still unidentified spiders in the International Barcode of Life (iBOL) database.